Steve Harvey @HarveyStev1223
Gene Maker // CEO and Co-Founder Camera Bio // PhD in Developmental Biology and BSc Genetics. England, United Kingdom Joined March 2024-
Tweets1
-
Followers39
-
Following247
-
Likes15
Keira Picquet @picqu_kei
56 Followers 5K Following
Ava Cunniffe @cunniffe75669
41 Followers 5K Following
Magali Mantik @MagaliMant74082
50 Followers 5K Following
Elliot Mostero @ElliMoste
54 Followers 5K Following
Gaia Cendan @CendanGa
33 Followers 5K Following
Tawanna Hencken @THencken44104
53 Followers 5K Following
Annette @annette9johnson
171 Followers 3K Following
Michael Sim @chicagodesign
64K Followers 1K Following Product Design Leader (UI/UX) | Mentor | Motivator | Finder of Why | I tweet insights on #UX #AI #AR #VR & the #Metaverse | Contributor @uxdesigncc & @prototypr
Christina @christina10meri
195 Followers 3K Following
Mittie Snipe @snipe16188
69 Followers 5K Following
Courtney Holterman @CourtneyHo88646
74 Followers 5K Following
Jerreh Manneh @jerrehmanneh559
334 Followers 2K Following every successful person has an painful story an every painful story has an successful ending bear the pain an get ready for success 🙏
Orlagh Steidl @ste_orlag
44 Followers 5K Following
Skyla Ciolli @CiolliSkyl68435
78 Followers 5K Following
Avis Cerutti @AvCerutt
34 Followers 5K Following
Riley Degrate @DegrateRil72993
103 Followers 5K Following
Harper Connor @harp_conn
46 Followers 5K Following
Karima Hassel @HasselKari33912
41 Followers 5K Following
Mariam Saunders @MariamSaun24729
14 Followers 719 Following
Lacie Meley @LMeley36823
88 Followers 5K Following
Marita Peddicord @MaritaPedd92203
43 Followers 5K Following
WebWaves @WebWaves2
630 Followers 934 Following Hosting, design, Local SEO, Organic SEO, PPC Marketing, Reputation Management, Social Media & more for small & medium-sized businesses across Canada & the US.
Jeff Sheehan Author |.. @jeffsheehan
309K Followers 320K Following #SocialSelling #Marketing Pro #Speaker #Author #AI | #ChatGPT Authority #Toastmaster Luv Travel |Photog | 13.1 #ATL
Marcelina Orduno @OrdunMarcel
70 Followers 5K Following
Bill M Moore @bmoore_20
136K Followers 125K Following Using #Twitter to build your #homebiz? | #Entrepreneur | Social Media Marketing | Motivational #quotes | #socialmedia
Mallory Cotton @MalloryCot67540
89 Followers 5K Following
Mary🍪 @MarySch23101711
1K Followers 4K Following
Jeffrey Feldberg @JeffreyFeldberg
138K Followers 130K Following Your Success My Obsession® ✤ 9-Figure Exit Entrepreneur ✤ Increase Profits and Enterprise Value ✤ Optimize Post-Exit Life ✤ Deep Wealth Mastery
Jasmine Taylor @JasmineTay39800
12 Followers 269 Following
Greg J. Marchand MD @MarchandSurgery
204K Followers 97K Following Dual board certified #MIGS & #OBGYN - against #genitalmutilation & #sterilization of kids under 18 for #GenderAffirming Surgery https://t.co/HRJLpqSuxG
Misty Mcfadden @MiMcfad
42 Followers 5K Following
Nakisha Lemasters @NLemaste
44 Followers 5K Following
Voice of Silence @Justice_Seeker5
59K Followers 15K Following Journeying through the universe within | Sharing insights & light on a path to enlightenment | In the pursuit of peace, love, & spiritual awakening, mindfulness
Susan McCann @Susanjmccann
123K Followers 64K Following Motivation Coach, Discover Your Inner Power by Changing your thoughts. Build a Mindset of Positive Health, Wealth & Success. ☀️Be Happy be Successful☀️
Suzanne Pardue @PardueSuzanne
205K Followers 151K Following Professional Photographer and Model | Published Writer | Passionate Traveler | In Love with Life... Life is an Adventure! Come follow me! ♥️
Rock Christopher @RockChristopher
220K Followers 171K Following ▪️Founder SuccessCENTER & #SuccessTRAIN #B2B ▪️#Brand & #Startup Advisor▪#ThriveInAI, #AI #Startups▪Writing Books 777 Top #AIApps Reviews & 10K+ AI Resources.
Kylie Riordan @mindfulheal
122K Followers 97K Following Sharing love snippets from my Soul • Mother • Psychotherapy • lover of all things beautiful • Author/Writer • Hypnotherapy • Spiritual • Chronic Disease Warrior
Real Marsha Wright® @marshawright
536K Followers 376K Following Serial-Entrepreneur & Influencer as seen on TV ★ LIFESTYLE SUCCESS PURPOSE Podcast & Academy ★ Host #ThinkBIGSundayWithMarsha ★ https://t.co/IISTO6yPQm
Ramblings @ramblingsloa
300K Followers 96K Following Trying to bring a smile 😊and spread some love 🥰 Find me on Threads and Instagram at ramblingloa ❤️
Kari Joys MS @KariJoys
165K Followers 87K Following ❤️ On a mission to help 100 women transform anxiety to personal power! ❤️ 35 years in Psychotherapy ❤️ NEW https://t.co/CmiYoBO1mR Program. Co-Creator of #JoYTrain.
The🐰FOO @PolitiBunny
148K Followers 19K Following Smile @ ppl who hate you. Head Conservative Rage Curator at @TwitchyTeam. IWF Visiting Fellow 🧡 Opinions mine. #Problematic #HappyWarrior #FancyPants
Eric Paley @epaley
37K Followers 2K Following Aspiring to build the most aligned VC for founders at seed stage @fcollective. Seed VC @TheTradeDesk, @Uber, @Cruise, @Airtable, @Whoop, @Embarkvet etc.
Dr. Manu Kumar 👋�.. @ManuKumar
34K Followers 3K Following Chief Firestarter @K9Ventures 🦮 (OG Pre-Seed) Investor @lyft @twilio @auth0 @lucidchart @everlaw @playosmo Co-founder @CartaInc 🥧 Co-founder & CEO @HiHello 👋
Joe Medved @joevc
7K Followers 653 Following Startup addict & @Cavs @CleGuardians fanatic. Partner @LererHippeau.
Rob Go @robgo
43K Followers 889 Following Lucky husband of @ntduke and father of two amazing girls. Cofounder of NextView. Built some product at Ebay and learned some investing at Spark Capital
Jeff Clavier @jeff
99K Followers 361 Following Founder of Uncork Capital, one of the OG seed VC firms. Invested in 260 cos at scary early stage. @bernadette hubby, dad of 2, wino, skier. Expect no bullshit.
Jeff Bussgang @bussgang
46K Followers 982 Following Former entrepreneur turned VC @Flybridge, teach @HarvardHBS, author of Entering StartUpLand & Mastering the VC Game. Civic innovator @Hack_Diversity, @GlobalEIR
Richard Dale @rdale
4K Followers 474 Following Techie, Entrepreneur, VC, Business leader ... loving career #4 (one where I have to say: opinions are my own)
David @ NextView @davidbeisel
23K Followers 825 Following Co-Founder & Partner @NextViewVC, seed investing in Founders redesigning the Everyday Economy including: @attentivemobile @TripleLiftHQ @thredUP @ParsecTeam
David Sze @davidsze
26K Followers 865 Following Father of three. Lucky husband. Proud brother. Partner at Greylock aka @GreylockVC. He/Him
Josh Kopelman @joshk
149K Followers 6K Following Father. Husband. VC. INTJ. Dad Joke Lover. Partner @FirstRound.
Ron Conway @RonConway
114K Followers 75 Following
David Cohen @davidcohen
177K Followers 524 Following Founder and Chairman at @Techstars. First round investor in 20+ unicorns like Uber, Twilio, DigitalOcean +more. Geeky to the bone. Podcasting on Give First.
Martin Zwilling @StartupPro
967K Followers 965K Following Veteran startup mentor, executive, blogger, author, tech professional, professor, and investor. Published on Forbes, Entrepreneur, Inc, Huffington Post, etc.
Steve Keating @LeadToday
1.0M Followers 788K Following Improving the Sales Profession, Developing the Next Generation of Leaders. Subscribe to my videos for excellent life and leadership mentoring!
Daniel Mezick @DanielMezick
267K Followers 58 Following
Kashif Shahzad @mrkashifshahzad
150K Followers 121K Following CEO @ MYK NEWS | Philonthropist | Real Estate Expert | Editor Daily Qadamt
Trevor Lund @trevorhlund
186K Followers 48K Following As I writer of speculative fiction, I enjoy talking to fictional characters...not necessarily meaning people on Twitter https://t.co/aAAwdVFYxv
TheNomadKing @TheNomadicKing
253K Followers 244K Following Best selling writer, speaker, influencer, YouTuber, and expert in nomad travel, photography, fashion, and entertainment https://t.co/NQvELGD11Z
Timothy Snow 🗣️ @SnowinRI
75K Followers 47K Following #INFJ - Problem Solver / Lifelong Learner. #DigitalPR Taking above-average to extraordinary. USAF 🇺🇸 Veteran now battling #PyschOps as #TargetedIndividual 🎯
Ken Herron @KenHerron
109K Followers 41K Following #CMO of 10-year-old #Sales #AI company @Strolid. Are you listening to your customers at scale? Let's talk — [email protected]! 🙉 #ActionableAI
Steve Gutzler @SteveGutzler
144K Followers 116K Following International Keynote Speaker on Emotional Intelligence for Extraordinary Leadership, Teams, and Sales. #Inspire #Greatness #Author #Golfer
Kevin Eikenberry @KevinEikenberry
65K Followers 26K Following Author of Remarkable Leadership. Cofounder of @BudtoBoss and @LeadingRemotely. Chief Potential Officer of @TheKEGroup. How can I help you be more Remarkable?
Doug Conant @DougConant
198K Followers 3K Following Founder & CEO ConantLeadership | Formerly: Chair, @CECPTweets; President @Nabisco; CEO @CampbellSoupCo; Chair @AvonInsider
James Strock 🇺🇸 @jamesstrock
14K Followers 3K Following American. Independent writer, speaker, reformer & entrepreneur | The Next Nationalism | RTs, Likes ≠ endorsements.
Michael McKinney @LeadershipNow
46K Followers 27K Following Lead From Where You Are. LeadershipNow works to build leaders at all levels and in all contexts. Leadership author, communicator, Coaching + Advisory Services.
Art Petty @artpetty
15K Followers 12K Following Executive/Emerging Leader Coach | Career Reinvent Coach | Leadership Caffeine & Management Excellence Blogger | Speaker | Workshop Leader
Neal Burgis, Ph.D. @Exec_Solutions
7K Followers 6K Following I coach Leaders and their organization on how to Get Unstuck. I work with CEOs, Executives, Business Leaders & Entrepreneurs.
Ray @AlwaysGoodStuff
18K Followers 20K Following Dr. Ray Calabrese is a hope-filed optimist, adventurer, #writer, #motivator. He believes our best days are in front of us. Life wins; Life always wins.
OWLS Dr. Joel @OrgWellness
21K Followers 20K Following 🦉 We catalyze healthy work cultures from the inside out with science ✒
Dan Tyre @dantyre
38K Followers 40K Following Entrepreneur, SMarketing pro,member of the HubSpot start up team,mentor, advisor, angel investor, strong believer in personal responsibility & GSD
Thomas Fiedler @ThFiedler
3K Followers 710 Following Thomas has more than 20 years experience in ABAP development tools and is the product owner of the ABAP Development Tools for Eclipse and the ABAP Test Cockpit.
SAP CodeJam Lingen @LingenSap
294 Followers 348 Following he/him SAP CodeJam Lingen. Hands on, ABAP Geeks, ABAP4HANA, Organisation: Marco Büscher
Łukasz Pęgiel @abapblog
1K Followers 181 Following Proud father of 3 devils 😈, husband, son, ABAP developer, almost blogger, nerd, Diablo & WOW fan, Rock & Football Star @ home. #SAPChampions
Christian Guenter @chris_guenter
444 Followers 850 Following
Paul Hardy @hardyp180
755 Followers 16 Following
Mike Doyle @mikedoyle.. @MikeEDoyle
1K Followers 397 Following I'm an independent SAP developer. I tweet mostly about work topics (UI5, Fiori, CAP & BTP in particular).
Excited for Aves… Decision made…@Baylor in the fall. Proud of you, kiddo 👊🏻🫶🏻 Sic ‘em
Good Friday Morning!! "Your morning or day may not be filled with sunshine and the road not as straight as you'd like. Embrace the good and cherish each moment, as time is fleeting." - #Jeffs #Quote #ThankfulFriday #FridayVibes #FridayMotivation #FridayMorning…
@EmelKurdoglu2 Emel, TYVM for the RPs, mentions, likes, and ongoing support. I greatly appreciate it. Enjoy the rest of your Friday and have a wonderful weekend in beautiful #Istanbul . Should be on everyone's bucket list!!
Managed to make some forbidden rock milk (calcium oxalate) that I'll use as a bacterial stand-in to calibrate and test the evolution robot. Crystals are insoluble and about 1x2 micron, which make for a neat ecoli turbidity simulant. Aaaaand power's out again, lol.
Is there a job where I can just make graphs in R and figures in BioRender all day? Because those are my favourite things to do 🥺
Trump's been banned from talking about the judge's family in the so-called hush money case in New York. Why? Because the judge's family was paid by the Biden campaign and is currently being paid by Adam Schiff. Trump isn't allowed to say the judge's daughter is a Democrat…
Nature paper on human-bacteria interactions but Yeast cells get the limelight. I approve
This week in Nature: Close connections - atlas reveals vast network of host-microbiome interactions Browse the full issue: nature.com/nature/volumes…
"Innovation occurs at the intersection of things. The greatest opportunity are in chaos in times of change, there's maximum opportunity, to change everything."
I asked a prospective postdoc to send me a one page proposal of what they plan to do in the lab. I sent them some topics to think around. I got an AI generated proposal and it was bad …. Should I not entertain the postdoc anymore or give another chance?
Some tools, for those playing along at home. web.expasy.org/translate/
AATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAGAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAAAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTGA
It’s insane that as a PhD student I have to go into personal debt to travel to a scientific conference, which is literally thousands of dollars, to present the work that I’ve done at an institution where PhD students are not seen as worthy of having corporate cards anymore.
Interested in Generative AI for BIO? Please Join George Church, David Baker and Sarah Carter for an interactive SynBioBeta Town Hall on "Generative AI for Protein Design: Balancing Risks with Opportunities". Tuesday Apr 16th at 12 noon pacific. You can register here:…
@DrZoeWaller Right-handed helix with a major and minor groove 😍😍😍
I have 2 postdoc positions open for people to come work in our lab in sunny London🧑🔬 Got goods skills in using synthetic biology and microbiology to make materials? Consider joining us on. Pls RT 🔁 jobs.ac.uk/job/DGV362/res…
Trends for United States
You might like
