CuFeLab @CuFeLab
Our group investigates how eukaryotic organisms respond to changes in the availability of copper and iron. We're at @iata_csic and @BiologiquesUV Joined February 2023-
Tweets307
-
Followers131
-
Following259
-
Likes392
We're happy to announce that our new paper on Cth2 is out! We show that the Cth2 G195R mutation found in some wild S. cerevisiae strains is important for their tolerance to high iron conditions, while it diminishes their capacity to grow under iron deficiency. #yeast #iron
📢 New review on #Candida infections! 🚨 🦠 Leading cause of hospital fungal infections ⚠️ Rising antifungal resistance (e.g., Candida auris) 📉 Outdated guidelines miss new threats 📖 Updated management recommendations inside! 👇 thelancet.com/journals/lanin…
Celebrando nuestra comida navideña en Delgadito Gastrobar 🎄🎄
La pasada semana tuvo lugar la reunión bi-anual de la Red Española de Levaduras con la participación de investigadores/as del IBFG: Pedro San Segundo, Andrés Clemente, Mónica Segurado, Sofía Muñoz, Sergio Rincón, Alfonso Fernández, Cristina Viéitez y Carlos Rodríguez
Científicos españoles descubren un mecanismo que podría explicar los trastornos del espectro autista. La clave estaría en estas 24 letras: GCAAGGACATATGGGCGAAGGAGA elpais.com/ciencia/2024-1…
📅 Hoy, 18 de noviembre, es el Día Europeo para el Uso Prudente de los Antibióticos 💊 👉 Por eso, hemos creado esta infografía con consejos y buenas prácticas para preservar su eficacia y así proteger nuestra salud y el futuro🌍 👀 Descárgala y compártela: ayúdanos a concienciar
Si visteis a Mª Jose y a @Marcos_dlP, del @IBMCP 😉💪, en @LaRevuelta_TVE y tenéis ganas de saber más sobre los #obeliscos, recomendamos este artículo de @manuelansede, sobre esta nueva entidad biológica. En @el_pais👇 elpais.com/ciencia/2024-1…
Ya he tomado la decisión. Os cuento como quiero correr la @maratonvalencia recaudando fondos para algún pequeño negocio afectado por la DANA. Os lo explico en este vídeo. Ya tengo reservados de IG 10€/km: km 1, 6, 7, 21, 22, 23, 27, 30, 32, 42 os sumáis? @IBV_CSIC @RUNNING_CV
Cuando en España se dedica miseria a la investigación, todos terminamos siendo algo más miserables. Necesitamos urgentemente que @CienciaGob tenga más recursos para repartir... Muchas gracias @davidbroncano y @LaRevuelta_TVE por visibilizarlo.
Cuando en España se dedica miseria a la investigación, todos terminamos siendo algo más miserables. Necesitamos urgentemente que @CienciaGob tenga más recursos para repartir... Muchas gracias @davidbroncano y @LaRevuelta_TVE por visibilizarlo.
👏🏻👏🏻👏🏻
Cuando en España se dedica miseria a la investigación, todos terminamos siendo algo más miserables. Necesitamos urgentemente que @CienciaGob tenga más recursos para repartir... muchas gracias @davidbroncano y la @LaRevuelta_TVE por visbilizarlo
Cuando en España se dedica miseria a la investigación, todos terminamos siendo algo más miserables. Necesitamos urgentemente que @CienciaGob tenga más recursos para repartir... muchas gracias @davidbroncano y la @LaRevuelta_TVE por visbilizarlo
Tomorrow, 15th Novembe), we are organizing a seminar morning at @iata_csic with 3 fantastic talks ( @pablocarb,@LukasBromig, and @spgarcica) related to "Building Self-Driving Labs in Biology".
El investigador del IBMCP @Marcos_dlP explicando que son los #obeliscos en #LaRevuelta @UPV @CSIC que no son extraterrestres 😜
Que aparezcan estas reivindicaciones en prime time en la televisión pública me parece BRUTAL. Somos miles los investigadores que estamos en situación inestable y llegando justos a fin de mes, y eso es intolerable. GRACIAS, Y MIL VECES GRACIAS.
Que aparezcan estas reivindicaciones en prime time en la televisión pública me parece BRUTAL. Somos miles los investigadores que estamos en situación inestable y llegando justos a fin de mes, y eso es intolerable. GRACIAS, Y MIL VECES GRACIAS.
Los datos sobre los premios Nobel revelan una red que se resume en tres consejos si quiere aspirar a uno de ellos: “Encuentre a alguien que ya lo haya ganado y trabaje con él, procure que su familia esté en el 5% de las que más dinero ganan y no sea mujer” dixitciencia.com/2024/11/12/los…
📝 Save the Date! We are hosting a workshop on research in Cell Factories. We'll explore the potential of genetic and metabolic engineering for the improvement of microorganisms for biotechnological purposes. 📅26/11 ⏰09:00 🔗Registration form: saco.csic.es/apps/forms/s/C…
Editor-in-Chief (XXX journal): These days, journals are finding it increasingly difficult to secure suitable handling editors and reviewers. Me: Perhaps it's time for journals to start sharing a portion of the APCs with editors and reviewers. What do you think?
Colorado RNA Club @ColoradoRNAClub
399 Followers 311 Following Fosters productive collaborations, rigorous debate, and enduring friendships between RNA scientists across Colorado. Fueled by 🍕, 🍺, and 🧬 since 1986.
Katie Green @KatieGreen7
120 Followers 363 Following
Tyrue Nguyen @tyruenguyen
159 Followers 4K Following
Dai Macedo 💚 @Daiana_Macedo
268 Followers 609 Following Sigo creyendo en sueños, que los días no tienen dueño, y que hay verdad y que hay amor. Cerrar los ojos es perder. Lic. en Biotecnología. Dra en Cs. Biológicas
Marina @Marinabarrba
140 Followers 93 Following 🎓PhD Biomedicine & Biotech Postdoctoral Fellow Harvard University Boston, MA, USA 🇺🇸
Esteban Ballestar @eballestar
979 Followers 532 Following Research Team Leader working on Epigenetics & Immunity | Barcelona
Marcos de la Peña @Marcos_dlP
713 Followers 304 Following @CSIC research scientist, freediver and #RNA lover
YeastGenomicsLab@NOVA @YGL_NOVAFCT
158 Followers 92 Following We use yeasts to study basic and applied aspects of microbial physiology and evolutionary ecology combining genomics with physiological and ecological studies.
Antonio Cilla Tatay @CillaMaravilla
26 Followers 140 Following
Plant physiology UPV @PlantPhysiolUPV
325 Followers 211 Following Sergio G Nebauer photoassimilate partitioning regulation
AGROALNEXT_GVA PPCC A... @agroalnext_GVA
259 Followers 456 Following Planes Complementarios Agroalimentación AGROALNEXT: El tejido I+D+i valenciano en acción
CIAGRO-UMH @CIAGRO_UMH
366 Followers 618 Following 🔬Instituto de Investigación e Innovación Agroalimentaria y Agroambiental🌲
B. Sabater-Muñoz @b_sabater
401 Followers 1K Following
Inma López Almela @inma_almela
149 Followers 512 Following Listeria | Immunologist | Human microbiome | #mujeryciencia
Paula Subirats Tarín @psubirats1
45 Followers 104 Following
Zaccheus Shehu @zaccheus_s99223
324 Followers 7K Following PhD candidate on removal Pharmaceuticals from water using magnetic nanocomposites.
Benagen-ONT @benagen3571
912 Followers 4K Following Professional in Nanopore Sequencing | Specializing in Ultra-Long Sequencing, and Direct RNA Sequencing| Driving innovation in genomics with advanced technology
Museu UV d'Història ... @MuseuHN
480 Followers 260 Following Museu de l'Universitat de València de Historia Natural. Estem al campus de Burjassot. T'esperem! #MuseuHN #MUVHN Altres llocs: https://t.co/UECBhihtpB
Antoni Garcia-Molina @GarciaMolina_A
232 Followers 274 Following Plant Molecular Biologist at @CRAGENOMICA. Interested on Systems Biology strategies to investigate molecular responses to combinatorial stress in plants.
Marsit Souhir @marsit_m
317 Followers 490 Following Associate Professor | Cellular physiology, Genomic Instability, Polyploidy, Hybridization, Adaptation, Domestication, Yeast, a Fairer World
Ferroptosis @Ferroptosis1
812 Followers 670 Following *not active*group for people interested in ferroptosis, iron and lipid biology to share their work and network. https://t.co/4C1eNLO1R1
Lucía Viñuela @VinuelaLucia
2K Followers 6K Following
Maria Bonet Aparici @BonetMaria19
8 Followers 29 Following Biotecnóloga y estudiante en el Máster de Investigación en Biología Molecular, Celular y Genética
Lydia Garrido @LydiaGGD13
387 Followers 2K Following PhD student at @mpi_marburg at Höferlab 🦠MSc Integrative synthetic biology🦠
IBV-CSIC @IBV_CSIC
2K Followers 389 Following Instituto de Biomedicina de València (Consejo Superior de Investigaciones Científicas @CSIC)
Emine Selçuk, PhD. @eminemselcuk
54 Followers 2K Following Postdoc Bacteriophage Researcher |Microbiology #phagetherapist. #Atatürk
拉丁裔学习中文 @latinoenchino
105 Followers 891 Following 你好！我正在学习中文，分享我的学习经验。如果我表达错了，请帮帮我 🤣 中文真的很难！我用 ChatGPT 来帮忙。
The Yeast(s) of South... @YeastofSA
70 Followers 415 Following Exploring the yeast side of southern Africa... https://t.co/QjTEoRbaX6
Adrian9420 @DonGazpachoWR
199 Followers 415 Following 21 | Biotecnología UV | TFG en @i2sysbio | Pablo Iglesias & Elyoya fan | a veces me espían | Becado en @iata_csic
Eva Balsa-Canto @BalsaCanto
269 Followers 365 Following Multiscale modeling of bioprocesses and biological systems. Exploring the microbial world. Bioproc. Eng. group IIM-CSIC (Spain) #WomeninSTEM #foodtech #biotech
CSIC Castilla y León @CSICCyL
2K Followers 1K Following DeIegación Institucional del CSIC en Castilla y León | Ciencia excelente con @irnasa_csic, @cicancer_com, @ibgm_es, @ibfg_es e @igm_leon 👩🔬🧪
Olimpiada Valenciana ... @OBiologiaval
50 Followers 79 Following Compte oficial de la Olimpíada Valenciana de Biologia. Sede de la XIX Olimpiada Española de Biología en abril 2024 ¡Os esperamos!
REDOLí_UV @redoli_uv
110 Followers 166 Following Grupo de investigación de reconocimiento, sostenibilidad e innovación @IDM_UPV_UV, @UV_EG
EventoCiencia @EventoCiencia
5K Followers 2K Following #EventoCiencia, la mayor comunidad de eventos de ciencia.
Asociación RUVID @asociacionruvid
4K Followers 2K Following Red de Universidades Valencianas para el fomento de la Investigación, el Desarrollo y la Innovación (RUVID).
Sara Muñiz Calvo @Saramuizcalvo1
64 Followers 111 Following Postdoctoral researcher in Biotechnology
Bionutest @bionutest
79 Followers 94 Following Diseñamos y evaluamos alimentos saludables y sostenibles. We are designers and evaluators of healthy and sustainable food products.
Microbiología y Tecn... @MicroTAmbienUGR
125 Followers 131 Following Cuenta oficial del grupo Microbiología Ambiental, de la Universidad de Granada. Official account of Environmental Microbiology group, University of Granada
Simone Mozzachiodi @SimoMozzachiodi
333 Followers 637 Following HFSP Post-doc, Kiran Patil's Lab 🇬🇧. Previously, Gianni Liti's Lab 🇨🇵. PhD, University of Nice and R&D Meiogenix. Master, University of Pisa 🇮🇹. 🔬🧬🖥️
CV+i Comunitat Valenc... @CViComunitatVal
185 Followers 144 Following Ecosistemas de innovación en la Comunitat Valenciana: circular, food, health, tourism, digital. #CViComunitatValenciana #S3CV
Enrique Meseguer @EnriqueMesegue1
132 Followers 663 Following Interested in Medical Innovation, Technology Transfer & Entrepreneurship, Innovation Systems. Researcher at @Ingenio_CsicUpv
Catedra EVES GSK UV @catedraEVES
159 Followers 350 Following Cátedra EVES GSK UV de la @UV_EG. Formación universitaria y profesional relacionada con la salud a través de jornadas, talleres y cursos.
UV International Rese... @oper_uv
1K Followers 770 Following International Research and Innovation Unit, Universitat de València
Aurelio Gómez @agomezcadenas
1K Followers 1K Following Biochemist. Professor at Universitat Jaume I de Castellón (Spain). Ciclista de montaña si hay almuerzo.
Brian Gibson @BrianGibson_TUB
421 Followers 420 Following No longer here, but there. @briangibsontub.bsky.social
Marina @Marinabarrba
140 Followers 93 Following 🎓PhD Biomedicine & Biotech Postdoctoral Fellow Harvard University Boston, MA, USA 🇺🇸
Esteban Ballestar @eballestar
979 Followers 532 Following Research Team Leader working on Epigenetics & Immunity | Barcelona
ELO @ElJanLe
549 Followers 346 Following Mujer, científica investigando la biología del cáncer, profesora universitaria
Science Careers @ScienceCareers
269K Followers 220 Following ScienceCareers is the careers component of @ScienceMagazine and produced by @AAAS. Scientists rely on Science Careers for #career information and #job postings.
Centro de Investigaci... @ciccancer
5K Followers 709 Following Centro de Investigación del Cáncer, centro de la Universidad de Salamanca, el CSIC y la FICUS Estamos en LinkedIn, Instagram, bsky con ciccancer Cuenta oficial
Marcos de la Peña @Marcos_dlP
713 Followers 304 Following @CSIC research scientist, freediver and #RNA lover
Nuria @NuriAndresColas
9 Followers 11 Following
Inger Skrede @IngerSkrede
322 Followers 174 Following Professor at University of Oslo, fungal biologist, mother of two.
YeastGenomicsLab@NOVA @YGL_NOVAFCT
158 Followers 92 Following We use yeasts to study basic and applied aspects of microbial physiology and evolutionary ecology combining genomics with physiological and ecological studies.
Plant physiology UPV @PlantPhysiolUPV
325 Followers 211 Following Sergio G Nebauer photoassimilate partitioning regulation
Horizonte Europa @HorizonteEuropa
18K Followers 1K Following Portal de Horizonte Europa en España | #HorizonteEuropa Información sobre el Programa Marco de Investigación e Innovación de la Unión Europea para 2021-2027
Rutter Lab @RutterLab
9K Followers 684 Following Official Rutter Lab Twitter | @UUtah | @HHMINEWS | #MitoMonday | #Mitochondria, #Metabolism & other cool stuff. Jared's tweets are signed -JR. Views are ours
GBl @GBlancoMo
3K Followers 591 Following
The Nobel Prize @NobelPrize
1.2M Followers 497 Following The official feed of the Nobel Prize @NobelPrize #NobelPrize
Scholarship for PhD @ScholarshipfPhd
237K Followers 28 Following PhD, Postdoc & Fellowship scholarships, research tips & more 📚 Stay updated & subscribe for exclusive premium content Promotion: [email protected]
Trends in Microbiolog... @TrendsMicrobiol
29K Followers 582 Following Reviews journal published by Cell Press. This account is not monitored, and content is automated. Please follow us on Bluesky: @cp-trendsmicrobiol.bsky.social
Nature Microbiology @NatureMicrobiol
74K Followers 2K Following Nature Microbiology publishes the latest research and commentary in all areas of microbiology. Now also at https://t.co/DBlricMTJ8
SMMCmicromadrid @SMMCmicromadrid
2K Followers 287 Following Sociedad Madrileña de Microbiología Clínica
mBio @mbiojournal
27K Followers 341 Following The American Society for Microbiology’s first broad-scope, online-only, open-access journal. Contact us at [email protected].
PLOS Pathogens @PLOSPathogens
32K Followers 2K Following A non-profit, #OpenAccess journal that publishes important new ideas on bacteria, fungi, parasites, prions, & viruses. Image Credit: Parish J, 2021
MicrobesInfect @MicrobesInfect
81K Followers 30K Following @MicrobesInfect covers the broad field of microbiology and host-pathogen interactions #openaccess Curated by: @ojcius
BPoD.cat @Bpod_cat
214 Followers 202 Following Imatge Biomèdica del Dia és un espai d'Aprenentatge-Servei, de divulgació biomèdica en valencià fet per biòlegs de la @UV_EG. Rèplica autoritzada de @BPoD_s
Museu UV d'Història ... @MuseuHN
480 Followers 260 Following Museu de l'Universitat de València de Historia Natural. Estem al campus de Burjassot. T'esperem! #MuseuHN #MUVHN Altres llocs: https://t.co/UECBhihtpB
Jose F. Marcos @marcosLab_
305 Followers 226 Following @CSIC Scientist at IATA @iata_csic - @FungalFact Fungi Biotechnology Phytopathology Microbiology - Views are my own
BioIronSocial @BioIronSocial
156 Followers 78 Following
Ferroptosis @Ferroptosis1
812 Followers 670 Following *not active*group for people interested in ferroptosis, iron and lipid biology to share their work and network. https://t.co/4C1eNLO1R1
IronBiologyBot @IronBiologyBot
288 Followers 1 Following Twitter Bot | automated to pick recent papers on #IronBiology from Pubmed | creator @LegoAnand | hosted from Muckenthaler lab @uniklinik_hd | #BioIron
Carla Gonçalves @ciggoncalves
453 Followers 515 Following Genome Evolution | HGT | Yeasts | Ecology prev PhD @YGL_NOVAFCT | prev Postdoc @RokasLab Currently Independent Researcher @FCTNOVA @UCIBIO_Research
Marsit Souhir @marsit_m
317 Followers 490 Following Associate Professor | Cellular physiology, Genomic Instability, Polyploidy, Hybridization, Adaptation, Domestication, Yeast, a Fairer World
Antoni Garcia-Molina @GarciaMolina_A
232 Followers 274 Following Plant Molecular Biologist at @CRAGENOMICA. Interested on Systems Biology strategies to investigate molecular responses to combinatorial stress in plants.
ASM @ASMicrobiology
91K Followers 280 Following Official account of the American Society for Microbiology. With over 36,000 members, ASM's mission is to promote & advance the microbial sciences.
Alex Mira @mira_ale
4K Followers 2K Following Microbiólogo, investigador del microbioma humano, apasionado por la ciencia y la vida
Sara García Alonso @Astro_SaraG
49K Followers 311 Following 📕 «Órbitas» | 🔬 Spanish biomedical researcher | 🚀 Member of the European Space Agency (ESA) Astronaut Reserve | 📩 [email protected]
Laura Álvaro Llorent... @Lauralvllo
261 Followers 247 Following PhD student at Evodynamics lab (Hospital Ramón y Cajal). New strategies against antibiotic resistant bacteria and AMR evolution in bacteria.
Barral lab @LabBarral
341 Followers 168 Following The Barral lab at the Institute of Biochemistry (IBC) at ETH Zürich. Updated by members of the lab.
Jesus rodriguez díaz @Jrodriguezbio
114 Followers 131 Following
Tania Jordá @TaniaJorda
56 Followers 36 Following
CIB 2025 @CIBValencia
961 Followers 381 Following XIII Congreso de Investigación Biomédica en la Facultat de Medicina y Odontologia de la Universitat de València Facebook: https://t.co/SPd2OsAHAm
Enrique Meseguer @EnriqueMesegue1
132 Followers 663 Following Interested in Medical Innovation, Technology Transfer & Entrepreneurship, Innovation Systems. Researcher at @Ingenio_CsicUpv
CSIC Castilla y León @CSICCyL
2K Followers 1K Following DeIegación Institucional del CSIC en Castilla y León | Ciencia excelente con @irnasa_csic, @cicancer_com, @ibgm_es, @ibfg_es e @igm_leon 👩🔬🧪
Olimpiada Valenciana ... @OBiologiaval
50 Followers 79 Following Compte oficial de la Olimpíada Valenciana de Biologia. Sede de la XIX Olimpiada Española de Biología en abril 2024 ¡Os esperamos!
COST PIMENTO @PIMENTOCA20128
105 Followers 75 Following PIMENTO Action CA20128- Promoting Innovation of ferMENTed fOods.
EventoCiencia @EventoCiencia
5K Followers 2K Following #EventoCiencia, la mayor comunidad de eventos de ciencia.
Asociación RUVID @asociacionruvid
4K Followers 2K Following Red de Universidades Valencianas para el fomento de la Investigación, el Desarrollo y la Innovación (RUVID).Trends for United States
You might like
