João Paulo Herrera @JPHerreraSilva
DSc candidate in Plant Pathology at UFV. Research interests: Plant Virus Evolution/ Viral Ecology/ Population Biology/ Begomovirus/ Temporal Dinamics 🇧🇷🇵🇦 Brazil Joined January 2018-
Tweets79
-
Followers348
-
Following673
-
Likes1K
Don’t miss it !!!!!! Please pass it on as large as possible #IS3DV2025
Invisible pathogens (or almost so) that cause the most beautiful symptoms seen in plant diseases. Symptoms of Begomovirus in Sida acuta 🌱✨️
Congratulations to @marielapga for the interesting study about the ecology/epidemiology of bleeding stem canker of Nothofagus spp. in Chile caused by #Phytophthora pseudosyringae. doi.org/10.1111/ppa.13…. Thanks @BS_PP for the great experience during the publishing process!
ATGGAGAGGAGGTACTGCCACAGGATCAGCACCATGGCCAGCGCCAACGACGCCCACGCCCCCCCCTACAACGAGTGGTACGAGGCCAGG from everyone at @ensembl
I'm very excited. Check out our chapter in the book Plant-Virus Interactions. link.springer.com/protocol/10.10…
I am very excited to share our latest paper published in the Journal of Plant Diseases and Protection. Isolation and whole-genome sequencing of tomato brown rugose fruit virus from pepper in Iran #ToBRFV #Virgaviridae #plantvirus link.springer.com/article/10.100…
Excellent conference, I had the opportunity to share some results of my research. In addition to having the pleasure of receiving an award for my talk in the plant virology session. #begomovirus #virusvolution #Cressdnavirus
Prof Murilo Zerbini opening the annual meeting of SBV @sbviro in Ouro Preto. An outstanding talk "Every virus everywhere all at once: Making sense of the viral mulriverse" encompassing the virosphere. @Virology_FAMERP @ACAV_ASTMH @ASTMH @UTMBProvost @ihii_utmb @CREID_Network
Exportin 1 is required for the reproduction and maize mosaic virus accumulation in its insect vector Peregrinus maidis. biorxiv.org/content/10.110… @NCSU_DEPP A huge effort by Cesar Xavier, Clara Tyson, and Leo Kerner. #arbovirus #rhabdovirus
I'm really excited to share our new paper, which has just been published in the Archives of Virology. link.springer.com/article/10.100… #ssDNA #plantVirus #Cressdnaviricota #Monodnaviria
The truth at my very center, and the reason I have always loved science
Anytime you think you understand #viruses, they get weirder. Meet Jingmen tick virus (JMTV), the 1st multipartite virus of primates discovered. What's weird about it? Imagine a group of people who travel everywhere together, but in different cars. That's the JMTV genome.
The great evolutionary geneticist Masatoshi Nei has died at 92. His work was incredibly influential - indeed, he garnered over 400k citations in his lifetime and wrote several important books on evolutionary genetics, incl. the 2013 book Mutation-Driven Evolution.
A Universidade Federal de Viçosa acompanhou com indignação e repudia com veemência os atos golpistas deste domingo ( 8 ). Confira a nota. tinyurl.com/2p84dfe3
Three Brazilian speakers in the session on Mutation, recombination and evolution. Today I had the opportunity to share some results of my project at the international ssDNA viruses symposium.
To ssDNA viruses lovers Detailed scientific program of #is3dv2022 is now available. Near definitive Note that we can still take a few registration 👇👇👇👇👇🏿👇🏾👇🏽👇🏼 is3dv-conference.org
So excited that our work creating a rhabdovirus infectious clone is being shared at #PlantHealth2022! Missing the first author @suryakanakala! Poster 369- Cesar will be here at 5PM to talk about the results. @NCSU_DEPP @virus_scientist @pegred73
Meme of the week!
Teaching undergrads plant viral diseases. Epidemiology: spatial-temporal dynamics and the role of vectors on epidemics and disease management. Thanks to @JPHerreraSilva for the outstanding lab practice. @ufvplantpath #fip301
Sheerri @Sheerri29300
8 Followers 98 Following
Mike Wingfield @leptograph
2K Followers 2K Following Founder Director (1998-2018) of FABI. Immediate Past President IUFRO. Tweets and opinions mainly regarding tree health are my own. @fabiteam1 @IUFRO @IUFRO_Mike
Maskell Growers @HealthySoilTech
522 Followers 4K Following We're a California based agricultural supplier, specializing in bio fertilizers and advanced soil amendments.
Ridi @Ridi2004
17 Followers 165 Following
Nik Cunniffe @nikcunniffe
1K Followers 2K Following Plant disease epidemiology, mathematical modelling and mathematical biology @plantsci and @GirtonCollege @Cambridge_Uni
Innovation Africa @UP @InnovAfricaUP
366 Followers 2K Following Innovation Africa @UPtuks - a research investment platform that host and develop #government - #industry - #university #research entities.
PlantVirologist @virologist77
49 Followers 394 Following
Satya B. Satapathy @Satapathy_21
195 Followers 680 Following Entrepreneur, Research Scholar @HydUniv, Curiosity on Intr. dscpln. sci. tech., Virology, Simplifer, Amazed, Hooman Kind. Fortunate to be @PlantSciUoh
SAGROPIA @Sagropia
87 Followers 146 Following SAGROPIA coordinated by the RTDS group and is a Horizon Europe project with 10 project partners. It's focus is on IPM focusing on potato n sugarbeet in Europe.
Bijaya Sapkota @sapkotabj150
21 Followers 205 Following #Divisional engineer at Norwegian Institute of Bioeconomy Research (NIBIO), Norway # Interested in Plant viruses and vector interaction. #Masters student
Jossue Ortiz-Álvarez @JossueMOrtiz
297 Followers 1K Following Microbiólogo y evolucionista 🧫🦕. Me encanta la difusión y la divulgación científica 🦠🧠🧬. SNI I. Investigador chavo . A veces me meto en política ✨.
G. R. Edwin @gr_bio
530 Followers 3K Following Ing. Agrónomo, https://t.co/5WIF7TfXu7 Fitotecnia, Ph.D Agronomía. Fellowship Francisco José de Caldas. Pro-Life and Proudly #Dad.
Dr. Bhanothu Shiva @Shivaagri12
136 Followers 905 Following Scientist, Plant Pathologist, Plant Doctor🌱💉🧫🧬🔬@Heartfullness institute, Kanha Santhivanam, Hyderabad
Didacte @carlelfuely
217 Followers 636 Following I love Plant Pathology |MsC Crop Protection | Feel free to comment my posts anytime , I am here for fun
APS Virology Committe.. @VirologyAPS
1K Followers 155 Following Virology Committee of the American Phytopathological Society @plantdisease
Zhengming Wang @zwang0614
166 Followers 179 Following Plant scientist, molecular biologist. Interested in plant immunity and epigenetics.
CJS LANDSCAPE SOLUTIO.. @CjsLandscape
123 Followers 550 Following spreading education in a fun way about plants and landscaping ideas that save you future headaches
Sara Salcedo S @Sarita1022
220 Followers 430 Following Agronomist, MSc and PhD in Plant pathology Biological control- plant pathogens. Molecular phylogenetics identification of plant pathogenic fungal
TALLHEDA @tallhedaproject
398 Followers 2K Following Horizon Widera Project creating a new long-term Alliance for DA between agricultural HEIs, and local and international stakeholders.
Asante Kwaku Joseph @pactodeciythog
205 Followers 1K Following Erasmus Mundus Scholar (EMPLANT +). Plant breeding |Plant genetics |Molecular Biology
Samuel Fasusi @samuel_fasusi
30 Followers 295 Following HPR Researcher||Fmr. Grad Research Fellow @IITA|| Husband
Ali Hasnain @Ali_Hasnain_Ch
115 Followers 458 Following MS Botany- Specialisation in Plant Pathology 🦠 and Plant Molecular Genetics 🧬 & Physiology 🌿
Teeleas @Teeleas13811
1 Followers 93 Following Compartilhando dicas para ganhar dinheiro de maneira rápida e eficiente. Acompanhe-me!
Imadud Din @imad_ud_Din
1K Followers 5K Following Lecturer (BPS-18) | Climate Change & Crop Production | The University of Agriculture Peshawar | PhD student at Laboratory of IMPRES | @Uantwerpen | Belgium 🇧🇪
mehmet @biyazayim
154 Followers 2K Following
Letismoa @letismoa11477
84 Followers 1K Following I live alone now and enjoy business, traveling, shopping, food and music. I have a calm personality and I hope we can be friends.
Journal of Plant Scie.. @JournalPlant
2K Followers 5K Following The International Research Journal of Plant Sciences (IRJPS) (ISSN: 2141-5447) is an Open Access, peer-reviewed journal. (Email: [email protected])
Hakan Hekimhan @HekimhanHakan
425 Followers 1K Following Cereal pathologist at Aegean Agricultural Research Institute in Izmir Turkey
NextGenBioPest @NextGenBioPest
516 Followers 2K Following NextGenBioPest is a Horizon EU project that meets the challenge of increasing crop yields, while reducing the use of chemical pesticides.
Dr Satyawan Grewal @satyawangrewal
1K Followers 4K Following Haryanvi, Farmer , Agronomist, soil & water conservator, Running own Farm @ Dr Manju Grewal # Grewal Organic Farming ,Training & Agritourism center # CCSHAU,
Biotechnology Confere.. @Biotech_conf
450 Followers 4K Following It is a pleasure to invite you to the 13th International Conference on Biotechnology on June 27-28, 2024 in London, UK
Mycothorailys @Hussaint789
961 Followers 2K Following Phytopathologist, 🔬🦠🧬🧫🔎🧪new Biomolecules; Molecular Markers, Disease Diagnostics;Bioformulations; Biosurfactant #FirstGen.
ಚೇತನ್ ಗ�.. @chethan18sep
45 Followers 270 Following ಹೆಮ್ಮೆಯ ಕನ್ನಡಿಗ, ಪಿಎಚ್.ಡಿ. ವಿದ್ಯಾರ್ಥಿ| Ph.D. Scholar ಸಸ್ಯ ರೋಗಶಾಸ್ತ್ರಜ್ಞ | Plant Pathologist | Plant Doctor @ University of Agricultural Sciences, Bangalore.
Hamza Mghari @MghariHamza
49 Followers 509 Following Researcher-Geospatial analyst Master of science in Integrated Pest Management Agricultural Engineer specialist in Plant Protection
Nicole Marie @NicoleMari30431
5 Followers 178 Following A girl from Hong Kong who loves to travel and enjoys all kinds of ethnic flavors.
pranit mukherjee @pranitmukherjee
125 Followers 1K Following
Lindsay Triplett 🌱 @triplettlr
2K Followers 2K Following Plant bacteriologist and Chair of Plant Pathology at the CT Ag Experiment Station in New Haven. Opinions my own.
selsabil boubegar @selsabilboubeg1
166 Followers 1K Following Master student at agriculture plante interested in the Plante medical and phytopathology 🌿 #plantes # medical plant ⵣ ❤️
Alejandro Olmedo-Vela.. @AOV_OlmedoVelar
872 Followers 1K Following 🇪🇨Biotechnologist @ESPEU, Plant Virologist @uhmanoa. Working with cotton viruses & other plant and insect viruses in the @HeckLab_USDA @CornellCALS
Dr Rabie Elshafey @RabieElshafey
1K Followers 5K Following Rice pathologist,prof. I am very interested in rice blast diversity ; bakanae, white tip nematode, kernel smut and false smut, sheath blight, science, art
Alejandro K. Llanos @Alejandrollm2
17 Followers 247 Following Agrónomo - Fitopatólogo| M.S.@NCState |B.S @UNALaMolina | Investigador |Enseñanza = Pasión | Aportando mi granito de arena para un Perú mejor 🇵🇪
M. Nadeem Khan PhD @Nadeem_11992
130 Followers 924 Following PostDoc | Microbiologist | level 1 Data Analyst | Microbiome | Fermentation | Antibiotic Resistance | Chronic Metabolic Diseases | Food & Nutrition
Yeluru Mohan Babu @YeluruMohan
96 Followers 2K Following PhD, Plant Pathology, Indian agricultural research institute
Not.Nath🦋 🦋 @NathanIgwe
172 Followers 808 Following Plant Pathology #Nematologist #nematology #nematodes #CropProtectionist
EVADE Lab @ Cornell @Cornell_EVADE
879 Followers 241 Following Epidemiology of VegetAble DisEases (EVADE) Laboratory
PlantVirologist @virologist77
49 Followers 394 Following
Satya B. Satapathy @Satapathy_21
195 Followers 680 Following Entrepreneur, Research Scholar @HydUniv, Curiosity on Intr. dscpln. sci. tech., Virology, Simplifer, Amazed, Hooman Kind. Fortunate to be @PlantSciUoh
Jossue Ortiz-Álvarez @JossueMOrtiz
297 Followers 1K Following Microbiólogo y evolucionista 🧫🦕. Me encanta la difusión y la divulgación científica 🦠🧠🧬. SNI I. Investigador chavo . A veces me meto en política ✨.
Dr. Bhanothu Shiva @Shivaagri12
136 Followers 905 Following Scientist, Plant Pathologist, Plant Doctor🌱💉🧫🧬🔬@Heartfullness institute, Kanha Santhivanam, Hyderabad
Didacte @carlelfuely
217 Followers 636 Following I love Plant Pathology |MsC Crop Protection | Feel free to comment my posts anytime , I am here for fun
Zhengming Wang @zwang0614
166 Followers 179 Following Plant scientist, molecular biologist. Interested in plant immunity and epigenetics.
Christian Landry @landrychristian
5K Followers 4K Following Scientifique, karatéka et curieux working on non-Artificial Intelligence. Mes opinions sont my own.
Sara Salcedo S @Sarita1022
220 Followers 430 Following Agronomist, MSc and PhD in Plant pathology Biological control- plant pathogens. Molecular phylogenetics identification of plant pathogenic fungal
Evolutionary Genomics @evol_genomics
4K Followers 310 Following Wanna know the newest papers, jobs and conferences in evolutionary genomics? Plz Follow me. RT = endorsement. Views are my employers.
Asante Kwaku Joseph @pactodeciythog
205 Followers 1K Following Erasmus Mundus Scholar (EMPLANT +). Plant breeding |Plant genetics |Molecular Biology
Mahan Ghafari | ما�.. @Mahan_Ghafari
3K Followers 642 Following Postdoc with @katrina_lythgoe @PSIOxford. Virus evolution & Epidemiology | @Ox_DTP @OxfordBiology alum | Tweets in English & Persian | Usual disclaimers
Claire Guinat @ClaireGuinat
730 Followers 381 Following Research fellow at INRAE (DVM, MSc, PhD) #epidemiology #phylodynamics #animal infectious diseases 🦠🐔🐮🐷🧬
Ali Hasnain @Ali_Hasnain_Ch
115 Followers 458 Following MS Botany- Specialisation in Plant Pathology 🦠 and Plant Molecular Genetics 🧬 & Physiology 🌿
UMN swine group @UMN_swine_group
2K Followers 268 Following Avid researchers, passionate teachers, and dedicated veterinarians, the members of the swine group focus on all aspects of swine health & management.
Imadud Din @imad_ud_Din
1K Followers 5K Following Lecturer (BPS-18) | Climate Change & Crop Production | The University of Agriculture Peshawar | PhD student at Laboratory of IMPRES | @Uantwerpen | Belgium 🇧🇪
Dr Satyawan Grewal @satyawangrewal
1K Followers 4K Following Haryanvi, Farmer , Agronomist, soil & water conservator, Running own Farm @ Dr Manju Grewal # Grewal Organic Farming ,Training & Agritourism center # CCSHAU,
Hakan Hekimhan @HekimhanHakan
425 Followers 1K Following Cereal pathologist at Aegean Agricultural Research Institute in Izmir Turkey
Mycothorailys @Hussaint789
961 Followers 2K Following Phytopathologist, 🔬🦠🧬🧫🔎🧪new Biomolecules; Molecular Markers, Disease Diagnostics;Bioformulations; Biosurfactant #FirstGen.
Mehdi Bouhaddou, PhD @DoctorBou
1K Followers 541 Following Assist. Prof. @UCLAQCBio @MicrobioUcla. Postdoc @KroganLab. PhD @BirtwistleLab. Phosphoproteomics + Math Modeling + Viruses. 50% dry, 50% wet.🇺🇸🇫🇷🇲🇦🏳️🌈
Hamza Mghari @MghariHamza
49 Followers 509 Following Researcher-Geospatial analyst Master of science in Integrated Pest Management Agricultural Engineer specialist in Plant Protection
Kirstyn Brunker @kirstynbrunker
1K Followers 663 Following Research scientist (she/her) at University of Glasgow: Rabies| MinION| Sequencing| Disease Ecology & Control| Viral evolution
Gareth (Gary) Trubl �.. @gtrubl
2K Followers 1K Following Dad| Staff scientist @Livermore_Lab| #firstgen PhD| He/Him| #Climate| Meta-omics| Stable isotopes| #soil #viruses| Ecology| Biogeochemistry| Astrobio| Geobio
pranit mukherjee @pranitmukherjee
125 Followers 1K Following
Lindsay Triplett 🌱 @triplettlr
2K Followers 2K Following Plant bacteriologist and Chair of Plant Pathology at the CT Ag Experiment Station in New Haven. Opinions my own.
selsabil boubegar @selsabilboubeg1
166 Followers 1K Following Master student at agriculture plante interested in the Plante medical and phytopathology 🌿 #plantes # medical plant ⵣ ❤️
Dr Rabie Elshafey @RabieElshafey
1K Followers 5K Following Rice pathologist,prof. I am very interested in rice blast diversity ; bakanae, white tip nematode, kernel smut and false smut, sheath blight, science, art
M. Nadeem Khan PhD @Nadeem_11992
130 Followers 924 Following PostDoc | Microbiologist | level 1 Data Analyst | Microbiome | Fermentation | Antibiotic Resistance | Chronic Metabolic Diseases | Food & Nutrition
Alejandro K. Llanos @Alejandrollm2
17 Followers 247 Following Agrónomo - Fitopatólogo| M.S.@NCState |B.S @UNALaMolina | Investigador |Enseñanza = Pasión | Aportando mi granito de arena para un Perú mejor 🇵🇪
Yeluru Mohan Babu @YeluruMohan
96 Followers 2K Following PhD, Plant Pathology, Indian agricultural research institute
Not.Nath🦋 🦋 @NathanIgwe
172 Followers 808 Following Plant Pathology #Nematologist #nematology #nematodes #CropProtectionist
Mohammad Shah Jahan, .. @shahjahansau
367 Followers 1K Following Associate Professor at Sher-e-Bangla Agricultural University
Ismam Ahmed Protic @IsmamProtic
244 Followers 1K Following Cell and Molecular Biology Phd student of University of Nevada, Reno. https://t.co/zVDqIGuLJ1
RENAVIPLANT @renaviplant
350 Followers 464 Following REd NAcional de VIrología de PLANTas (RENAVIPLANT). Spanish Network of Plant Virology. Over 14 research groups aligned in this topic! held by Pedro Gómez.
Dorith Rotenberg @DorithRotenberg
438 Followers 321 Following Professor, NCSU, USA; Ecological Genomics of Plant Virus-Vector Interactions; Vector Biology
CJS LANDSCAPE SOLUTIO.. @jonnyplants
833 Followers 2K Following Owner of CJS landscape solutions and would love to educate and share my knowledge about landscaping and the amazing beauty of all different plant forms 🌴🌵🌎
VignuzziLab @VignuzziLab
16K Followers 9K Following viruses-evolution-Singapore-fitness! @idlabs_astar. #PrideInSTEM 🏳️🌈 #DiversityInSTEM 🇸🇬🇮🇹🇨🇦🇫🇷🇺🇸🇸🇦🇬🇧🇭🇺🇲🇾
Ken Zane Windstein @dendroken
89 Followers 361 Following BSc. Forest Health, MSc. Natural Resources Interested in bark responses to biotic and abiotic stressors BLM
Seth Bordenstein @Symbionticism
11K Followers 2K Following Scientist, Huck Professor: Microbiome, Symbiosis, Genetics, Evolution, Wolbachia, #PhageWO | Education @WolbachiaProj | One Health Microbiome Center @PSUmBiome
Sourish Pramanik @SourishPramani4
375 Followers 3K Following Masters Plant Pathology, PAU '25 | Bachelors in Agricultural Sciences, VBU '23 | Interested in Genomics, Molecular Crop Improvement & Bioinformatics
Venkatesh Basavaraj @basavaraj9483
480 Followers 2K Following Research Scholar Ph.D in Botany (Nematology🪱) Plant pathology, Host-pathogen interaction. University of Mysore, Mysuru, Karnataka India🇮🇳
Thaís Dal'Sasso @thaisdalsasso
115 Followers 135 Following Postdoc at the Environmental Genomics Group | Plant Geneticist interested in Molecular Evolution, Computational Biology, and Plant-Microbe Interactions
APS Postharvest Patho.. @APS_PHC
369 Followers 624 Following Twitter account for the American Phytopathological Society (APS) Postharvest Pathology Committee | @plantdisease
UF/IFAS Plant Root Bi.. @UFRootBioLab
2K Followers 3K Following This is a channel of communication for Dr. Rossi plant root biology laboratory at the University of Florida. @UF | @UF_IFAS | @ufhorticulture | @UFIFAS_IRREC
Monique Rivera @moniquejrivera
3K Followers 1K Following Entomologist | Assistant Professor, @cornellento Insects, plants, & your food💕🍎🍊🌳 Rivera Lab: @sandra_lizg @JanePetzoldt @kelseytobin_
Sultan_Jameel_0waisi @sultan_CUI1973
352 Followers 324 Following Lecturer| PhD Candidate Mycoviruses| Mycotoxins| (CDRI)
javier é assim
gatinho criado por vó
Don’t miss it !!!!!! Please pass it on as large as possible #IS3DV2025
daniel do mais completo nada: a beyoncé quando ela foi traída ela lançou o lemonade, né? 👀 o belo vai lançar o caipirinha @eueindaniel
Hybrid speciation driven by multilocus introgression of ecological traits nature.com/articles/s4158… @Nature
Ilusionante y enriquecedor claustro el de hoy, mucho futuro @i2sysbio!!!
El Claustro del instituto ha podido debatir hoy con las personas que configuran la candidatura a la Dirección @GustavoGomezLab @RosarioGilGar2 @JavierBuceta mucho consenso (parten con el apoyo unánime de los votos emitidos) y mucha ilusión para afrontar los grandes retos.
Grateful for all the access and opportunities provided! @edelponte #IEW13
In addition to epidemiology and science #IEW13 has provided excellent networking possibilities and relaxing moments with fellow epidemiologists!
Very proud of my student Mandeep! This was a great honor for both of us from @ClemsonCAFLS and I was glad to be able to celebrate with @tayal_mandeep !!
I am happy to share that I received Outstanding Graduate Research Assistant Award from @ClemsonCAFLS. My advisor @ejcieniewicz received two awards: Outstanding Junior Faculty in Research and Teaching. Congratulations and it’s a big day for our lab 🎉👏. Grateful 🥹.
Detection of Mycoplasma hyopneumoniae viability using a PCR-based assay umnswinenews.com/2024/04/09/det…
There is a funded Master Student position available in my lab, please help to spread the word!
Possibly the most important ecology paper published in Science this century?...science.org/doi/10.1126/sc…
me fantasiei de Merida pra festa da Júlia, mas fiquei bêbada antes de tirar uma mísera foto com o arco e flecha kkkkkk
o maior pavor da minha vida de professora é o famigerado surto de piolho, tenho pesadelos com esse bicho fazendo rapel nos meus cachinhos
Absolutely savage stuff 🙈
So excited to see my first postdoc in my life!!! 👩🏻🔬 @UNL_PlantPath @UNL_PSI
Just in case you were missing this beauty 🌿☀️🧪
SCOOP: this is BIG. Bellman Conformal Inference: Calibrating Prediction Intervals For Time Series” 🔥🔥🔥🔥🔥🚀🚀🚀🚀🚀. @Stanford paper by @ZitongYang0, @lihua_lei_stat and the great Emmanuel Candes. 🚀 Bellman Conformal Inference (BCI), a framework that wraps around any time…
TRAILS: Tree reconstruction of ancestry using incomplete lineage sorting | PLoS Genetics journals.plos.org/plosgenetics/a…
@Prof_GD_Foster My preference is wordart.com this is the Fera virology lab effort from 2023 brought to you by @AimeeFowkes @holiines @IPAdams
Word cloud your papers via link below using your Google Scholar Good to see PLANT & VIRUS nice and big. shiny.rcg.sfu.ca/u/rdmorin/scho…
Trends for United States
You might like
