KeyMaker_VIII @KeymakerViii
“The answer is out there. It’s looking for you and it will find you if you want it to.” Joined June 2021-
Tweets3K
-
Followers89
-
Following345
-
Likes2K
A SECOND @Boeing whistleblower has DIED!! 😬 Pure coincidences, of course.
Congress is suddenly rushing a bill to ban “antisemitic speech” in places like… college campuses. (HR 6090) Criticizing Israel or claiming Jews own the media is obviously included. So naturally, ima exercise some free speech and do both those things. Cuz Fuq you guys.
Australian Swimmer Mikey Wright charges into the water to save a drowning woman
❤️😎American 🇺🇸 Guts
TAYLOR SWIFT SATANIC AGENDA Taylor Swift is an occult witch who is pushing an agenda to desensitize our youth to Satanism, witchcraft, and the occult. His main goal is to corrupt their minds through his music.
John Sullivan "Jayden X" was sentenced to six years in prison yesterday for his role in the January 6th. Was Jade Sacker ever arrested?? Or do we only arrested conservative journalists like @TPC4USA and JD Rivera? Jade Sacker (JS): "We did it!" Sullivan: "Dude, I was trying…
If everything can be faked, then nothing is real.
🧐Guess which congressman bought Meta Stock right before the Vote‼️👇
It’s easier to fool people than to convince them that they’ve been fooled
Pay Attention 👇🏽
@BrittWoo10782 @TrialsiteN @JesslovesMJK @AdhesionsOrg Explanation in here arkmedic.info/p/the-new-euge…
WOW! Trump just retruthed this very interesting article, and now I think I understand the purpose of some of these bullshit 'show' trials - to eliminate Special Counsels! Turns out they're designed to prosecute political opponents and should be eliminated. city-journal.org/article/no-mor…
@RealCandaceO Learn more about it here. rumble.com/v21xn4o-pop-ep…
Busted… rumble.com/v4qxvxk-ukrain…
Nothing to see here…move along libertysentinel.org/bestiality-tau…
Wow. I'm speechless.. Prepare to have your mind blown. Great find JFanon. I'm blown away at how perfectly it encapsulates our topic on tonight's show. Do yourself a favor, and watch this through. Then join us tonight at 9pm east on Rambo and Frens. I'll attach links…
Wow. I'm speechless.. Prepare to have your mind blown. Great find JFanon. I'm blown away at how perfectly it encapsulates our topic on tonight's show. Do yourself a favor, and watch this through. Then join us tonight at 9pm east on Rambo and Frens. I'll attach links… https://t.co/EVSVNuCGB4
Why was SV40, a cancer causing sequence, put in the Covid Vaccine? Because Cancer is the Medical Industrial Complex’s #1 money maker. Now, 20 year olds are getting turbo cancer, and those who were once in remission have had their cancer come back 10x worse.
Woody Harrelson knew exactly what he was doing when he made this joke.
Kerry Swierczek @KerSwiercz
0 Followers 39 Following
_c_rush @crush550149
19 Followers 225 Following
Meadow Shaker @MeadowShak16261
52 Followers 5K Following
Honor 😍 @Honor__S21
3 Followers 572 Following Sеnsuous seductrеss relеntlеssly pursuing eсstаsy unboundеd
_Aria9_ @Aria94659248203
7 Followers 299 Following
Alix Odaniel @odani_ali
42 Followers 5K Following
Aiza Surridge @AizaSurrid
87 Followers 5K Following
Kera Chodorov @KChodorov61681
91 Followers 5K Following
DarellHeaps @DarellHeap99809
23 Followers 848 Following
Eiliyah Picerno @PicerEiliy
88 Followers 5K Following
Umme Hoeschen @hoesch_u
72 Followers 5K Following
Divine Drive @DivineDriveVids
754 Followers 1K Following "Do not be afraid; keep on speaking, do not be silent."
Elon Musk @ElonMusk44102
151 Followers 3K Following 🚀| Spacex • CEO & CTO 🚔| Tesla • CEO and Product architect 🚄| Hyperloop • Founder 🧩| OpenAI • Co-founder
Benjamin Downing @BenjaminDownin5
15 Followers 189 Following
Love_ALL @Simplelovelive
917 Followers 4K Following love and empathy are the highest order of intelligence
Almost Amish @AlmostAmish1
15K Followers 15K Following Pioneer log cabin off grid living. Homesteader trying to save the world. #MAGA #Patriot #Pureblood, GodBless America, God Family Country. I will not comply!
Antonetta Tiwald @AntonetTiwal
34 Followers 5K Following
Elena Capati @capati_ele27542
71 Followers 5K Following
Analia Plank @AnaliaPlan28057
28 Followers 5K Following
Juliet Edgerton @JuliEdgert
50 Followers 5K Following
Lashell Harvel @LHarvel27565
38 Followers 5K Following
Marcella Lamoree @LamoreeMar93192
92 Followers 5K Following
Victoria Luck @LuVictori
77 Followers 5K Following
Jimmy Norberg🍿Q�.. @jimmy_norb12658
2K Followers 2K Following Make the world a better place FOR WE THE PEOPLE WWG1WGA 💪 Swedish patriot 🇸🇪DRAIN THE SWAMP 👊 Trump 2024👌
Mackenzie Melling @MackenzMelli
25 Followers 5K Following
Bobbie Ty @TyBobbie69327
75 Followers 5K Following
AwakenedOutlaw⚒️ @AwakenedOutlaw
240K Followers 14K Following To hell with them fellas. Buzzards gotta eat, same as worms. 🔥PRIMARY ACCT🔥 Also: @OutlawJW God & Country!!! 🇺🇸 Believer, Father, Veteran & Patriot
Amelia @peuomsao72376
99 Followers 226 Following Proud America🤝, 🇺🇸. play golf⛳️. #Country, #Family, #God. single💯. Happiness❤️
JeromeToromanides @JToromanid93682
88 Followers 2K Following
Just James @InfectiousMasc1
2K Followers 3K Following America is great! Cheerful not fearful! Conservative, individualist. Snarky but not mean. I'll give everyone a chance.
Qᴀɢɢ.ɴᴇᴡꜱ @qaggnews
11K Followers 6K Following Follower of the one true God, Jesus Christ, and the Holy Spirit. Save children, end trafficking, NOW. Follow me at your own peril. Citizen journalist.
Qtime @Qtimekennedy
5K Followers 301 Following I slept and dreamt that life was joy. I awoke and saw that life was service. I acted and behold, service was joy. 🇳🇱 🇺🇸
Seedeph @seedeph43966
191 Followers 6K Following
Defender of the Repub.. @realdefender45
89K Followers 2K Following Defender of Freedom, Truth & Justice
Snarkish Danno 🇺�.. @AgesSnark
11K Followers 10K Following Yall know. If you dont, you will ;) Been at this since early ‘18 on the official front. Been researching for 40+ years now….
Faith Warrior7777 @warrior77755434
28 Followers 230 Following
Feisty-n-Friends ⭐�.. @FriendsFeisty
8K Followers 1K Following For those who have faith, no explanation is necessary. For those who do not, no explanations are possible. Supplemental account for @CHHR01 Feisty Cat.
Anna 😍👗👖❤�.. @zd_Annar
44 Followers 256 Following Building brands and making bold moves. Owner of a skincare line, clothing design company, restaurant, and fashion design business. #ladyboss🚫PORN
Bama_Jeans @bamajayt
29K Followers 19K Following Beach Bum #MAGA #RollTide #RealScienceMatters Microbiologist #FightBack No DMs! Pronouns -ToldYaSo 5th time...65k friends went poof. Truth hurts
James Li @5149jamesli
24K Followers 2K Following "Every time you say what’s true, you do your bit to help weaken the lie" Host, 51/49 with James Li. Contributor, @BreakingPointsN with Krystal and Saagar
Dudes Posting Their W.. @DudespostingWs
2.3M Followers 26 Following Ironically Funny and Wholesome. DMs open for submissions 🥂 DM for Removal or Credit
Shipwreck @shipwreckshow
41K Followers 696 Following fe·male /ˈfēˌmāl/ 🔥 Politics with a little spice 👽
Lily Tang Williams @Lily4Liberty
67K Followers 9K Following Candidate (R) for Congress 2024 #NH02 | Survivor of Mao's Cultural Revolution | Live Free or Die | Entrepreneur and Professional Speaker | Wife and Mother |
𝙰𝚊𝚗𝚘𝚗 @AAnon55
56K Followers 526 Following Irregular warfare is warfare. We are at war! Blessed be the Lord my strength who trains my hands to war & my fingers to fight. We won't stop until victory 🇺🇲
Whitney Webb @_whitneywebb
350K Followers 964 Following Contributing editor of https://t.co/i6XvCQ62PW, author of One Nation Under Blackmail. Follow me on Nostr + other Twitter alternatives (see link tree below)
Hannah Barron @HannahBarron96_
221K Followers 73 Following 27 "The Catfish Girl" #GetBit #IAM1STPHORM • Huntin' • Fishin' • Noodlin' • Bowfishin' •
🦍Sno™🥶 @vrotocol
7K Followers 381 Following 2011 & 2012 Infowar World Champion Followed by the finest
Shareef @HunnyDippReef
2K Followers 484 Following
Corey Lynn of Corey's.. @CoreyDigs
11K Followers 595 Following Main acct fried Investigative journalist, co-host of Dig It! Podcast & The Solution Series Podcast: https://t.co/ErkR0J0xq1 Patreon: https://t.co/BYTZ7BtwpE
RealAF Patriot @RealAF_Patriot
10K Followers 785 Following Citizen Journalist 💣 Video and Content Creator 🔥 Digital Soldier ⚔️ Trusting The Plan (Q) 🐸 WWG1WGA 🇺🇸 NCSWIC ⛈️
Jimmy Norberg🍿Q�.. @jimmy_norb12658
2K Followers 2K Following Make the world a better place FOR WE THE PEOPLE WWG1WGA 💪 Swedish patriot 🇸🇪DRAIN THE SWAMP 👊 Trump 2024👌
Robert Sepehr @robertsepehr
91K Followers 1K Following Robert Sepehr is an Anthropologist https://t.co/c2aONx1r3M Watch my free videos: https://t.co/l8YP9kjZL3 I follow back subscribers. ⚡
Matt Wallace @MattWallace888
1.8M Followers 10K Following CEO of #Titter ~ @ElonMusk Council ~ Turn The Notifications On For Real-Time Breaking News Alerts! #FreeSpeech📣 #Dogecoin🐕 #ElonMusk 💼 @DianaWallace888 💍 ⛪️
TraderGirlQ @TraderGirlQ
41K Followers 6K Following CRAZY Conspiracy Theorist, Anon, Investor, & Researcher, Not a financial advisor NCSWIC (I DO NOT HAVE ANOTHER ACCT ANYWHERE, DON'T GET SCAMMED) 💗💞💗 🦋
Larry Cook @stopvaccinating
66K Followers 2K Following Abolish all medical mandates! Click the link to join my email list, take my free vaccine free parenting course, discover vax dangers, & challenge vax mandates.
Qᴀɢɢ.ɴᴇᴡꜱ @qaggnews
11K Followers 6K Following Follower of the one true God, Jesus Christ, and the Holy Spirit. Save children, end trafficking, NOW. Follow me at your own peril. Citizen journalist.
clif @clif_high
146K Followers 29 Following radical iconoclast ~ Time powers everything. Harmonize with Irreversiblity.
rebelEducator @rebelEducator
139K Followers 317 Following Corrupting the youth. Enthusiasts exploring the future of learning. Follow for ideas on how to improve your child’s education.
Jessie Czebotar @CzebotarJessie
70K Followers 968 Following "I will instruct you in the power of God...". Job 27:11 Chaplain, Support Military & Vets, See PATREON to donate https://t.co/bkQiTEO64o
40_Head @TheReal40_Head
25K Followers 371 Following Christian Husband, Father and Patriot here to learn, follow and lead. Creator of audio series "Inside 40's Head - A Patriot's Perspective". (Formerly 40_Head)
Ashton Forbes @JustXAshton
105K Followers 6K Following Citizen Journalist & High Technology Unification of Quantum and Macro Organizer of MH370x https://t.co/rl9KbR8iol Views expressed are mine alone.
StormyJ @StormyJ_45
20K Followers 2K Following Partner on Brainstorm podcast. Come watch us on Rumble. https://t.co/gTHmeOnbok Telegram community. https://t.co/z9H6EWCTSQ
Qtime @Qtimekennedy
5K Followers 301 Following I slept and dreamt that life was joy. I awoke and saw that life was service. I acted and behold, service was joy. 🇳🇱 🇺🇸
Elizabeth P. Dove �.. @ElizabethPDove
32K Followers 5K Following Lizzy to my friends. Writer. Researcher. Punisher's Carrier Dove... IYKYK https://t.co/mWdBxPxguC
Ian Carroll @Cancelcloco
384K Followers 378 Following Cancel This Clothing Company on all the apps. Follow the money. Seek the truth. OSINT journalism. Exposing globalism. Not an expert at anything but sarcasm.
Leonidas Official @Leonidas_17GOI
7K Followers 798 Following There can be no Return to Normal because Normal was the Problem in the First Place
Paul Schmidt @Sapioplex
3K Followers 162 Following Digital Soldier, Est. 11/2017 Learn as much as you can and patterns emerge. This isn't about finding the truth. This is about learning HOW to find the truth.
Snarkish Danno 🇺�.. @AgesSnark
11K Followers 10K Following Yall know. If you dont, you will ;) Been at this since early ‘18 on the official front. Been researching for 40+ years now….
MikeCristo8 @MikeCristo8
53K Followers 3K Following RN and Economist. watching imperialism regimes fall one by one, Trudeau, Macron, Merkel, WEF, NWO 🇨🇦 DEFEAT @WEF and globalism. 🇷🇺 defeat NATO
IPOT_theOfficial76 @IPOT_Official76
27K Followers 2K Following I make documentaries & get pursuity. https://t.co/utqC9WoWOU https://t.co/da1eThYUeA https://t.co/yZcUzf09o8
Redpill Drifter @RedpillDrifter
129K Followers 5K Following Man looks in the abyss, there's nothing staring back at him. At that moment, man finds his character. And that is what keeps him out of the abyss.
Joe Rambo @BrainStorm_Joe
138K Followers 4K Following Rambo And Frens podcast RamboAndFrens on Rumble, https://t.co/xomYkXflix, Telegram, and YT.
MrDirt @MrDirt66
3K Followers 759 Following NIGHTSHIFT... Game on! RT's r not endorsements . Overturn Citizens United!! Buckle up! joined shthole twitter 2011
Wyatt @austerrewyatt1
116K Followers 2K Following Leftism is a mental disorder. WEF is a terrorist organization. Greatest account you ever followed. Love my followers.
Donnie Darkened @DonnieDarkened
126K Followers 4K Following "Be sober, be vigilant; because your adversary the devil, as a roaring lion, walketh about, seeking whom he may devour." 1 Peter 5:8
The Punisher @PunishDem1776
290K Followers 6K Following Natural Justice is the only True Justice. Slaves No More. Give it your all, or give up all. Live on ur feet, or die on your knees. Know your enemy🔥
Feisty-n-Friends ⭐�.. @FriendsFeisty
8K Followers 1K Following For those who have faith, no explanation is necessary. For those who do not, no explanations are possible. Supplemental account for @CHHR01 Feisty Cat.
Dr. Jan Halper-Hayes @Biz_Shrink
70K Followers 3K Following Political Psychologist & CEO Strategy Fmr. Global V. P. Republicans Overseas/Republican Commentator @GBNews @BBCWorld @Sky @CNBC @CNN Breitbart #MAGA
We Have It All @WeAreWoke1776_3
95K Followers 2K Following we are watching a🎥 🔥TRUMP IS STILL YOUR PRESIDENT🔥
Vizion4theBlind @Vizion4theBlind
941 Followers 21 Following Backup account to @vision4theblind Will start posting here if that account get suspended
🍻𝐁𝐞𝐞𝐫 .. @ScottZPatriot
14K Followers 2K Following Awaken gently: https://t.co/b2aJuE3e1z • Get help with mental stress, anguish, trauma and/or addictions, or to book @TheoFleury14 on your show: [email protected]
Vision4theBlind @Vision4theBlind
63K Followers 391 Following “It's easier to fool people than to convince them that they have been fooled.” | Backup: @Vizion4theBlindWhy is it that Israel's 1967 ATTACK on USS Liberty--killing 34 American servicemen and wounded another 171, remains the only case of an attack on a US ship without a full Congressional enquiry. 🤔 Liberty survivors have continued to argue that the attack was intentional and that…
If I’m home he is sitting next to me. I already lost one and now this guy is getting up there in age. Enjoying every minute I have with him. Crazy how fast time flies by.
People who are in favour of higher taxes and big government programs are just low IQ scavengers of human misery.
Just put the boat in the water and we're ready to get summer started. Sunday we're gonna take it out and have a big barbecue and catch some fish.
@mRNAdeaths People need to understand the significance of #taggate. The 3 GMO "codon optimised" vaccines (Pfizer, Moderna and Novavax) do not have random codon optimisations. They converged at one specific sequence, that just happens to make you #CRISPRready. x.com/jikkyleaks/sta…
@TrialsiteN Is that because we caught them out having colluded to conserve a gene sequence between all the companies that just happened to have a PAM sequence? Bookmark this sequence 👇👇👇👇👇👇👇 ATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACCGG #CRISPRgate @JesslovesMJK @AdhesionsOrg
@BrittWoo10782 @TrialsiteN @JesslovesMJK @AdhesionsOrg Explanation in here arkmedic.info/p/the-new-euge…
Investing in your health will save you money in the long run. And pain.
WOW! Trump just retruthed this very interesting article, and now I think I understand the purpose of some of these bullshit 'show' trials - to eliminate Special Counsels! Turns out they're designed to prosecute political opponents and should be eliminated. city-journal.org/article/no-mor…
@RealCandaceO Learn more about it here. rumble.com/v21xn4o-pop-ep…
A beach in the 70's. Not one fat body. My, how the food industry destroyed us.
Remember... If all the headlines are identical, it's not news, it's advertising.
Do the Democrats have a video of this guy banging a goat or something? The mantra today is that the white male is always the privileged villain. Unless, of course, you need somebody to pay the taxes, or sacrifice his life on the battlefield. So sick of this shit.
Mike Johnson believes that white privilege is real and systemic change is needed. How is this man the GOP Speaker?
The CIA took down the Kennedy FBI report off archive dot org. So naturally I reuploaded it. Cuz fuck em, that’s why. archive.org/details/Ted-Ke… This document is a must read. It’s 22 pages and details the largest drug smuggling operation in recorded history- Perpetrated by Bush…
@AtRealBen x.com/warnuse/status…
'Seven Countries In Five Years.' General Wesley Clark Reveals U.S. / Central Bankers Plan To Invade Iraq, Syria, Lebanon, Libya, Somalia, Sudan And Iran.
Those who are able to see beyond the shadows and lies of their culture will never be understood, let alone believed, by the masses.
Be careful who you follow. Litecon >Bull< is posting a doctored picture of Melania. The real dress does not have a Q. mirror.co.uk/3am/style/cele…
Let's Tie It All Together. Dress Codes Matter.
The media won’t show you this
Trends for United States
You might like
