Sneha Surya Narayana Murthy @MurthySneha
Interdisciplinary PhD Student @DalhousieU #DalhousieU #metagenomics #microbiome #Research Halifax, Nova Scotia Joined February 2015-
Tweets760
-
Followers446
-
Following3K
-
Likes8K
Some Priestia fun! biorxiv.org/content/10.110…
Some Priestia fun! biorxiv.org/content/10.110…
We take great pride in announcing that @official_ibab has been ranked 3rd amongst Indian research institutes for launching a Bioinformatics career: biotecnika.org/2024/03/top-20… Strong collaborations b/w IBAB's computational & experimental PIs ignite such interdisciplinary excellence!
📢'Gastrointestinal and brain barriers: unlocking gates of communication across the microbiota–gut–brain axis' Our latest review just out in @NatRevGastroHep with @jfcryan #BloodBrainBarrier #GutBarrier #ChoroidPlexus #microbiota 🦠🧠🔬 Read here: rdcu.be/dyDPm
A recent review highlights that changes in fear-related mental health conditions are observed when the gut microbiota is altered or removed. #microbiome | #health | #digitalhealth microbiomepost.com/estrogen-and-g…
#CollegeFest You are invited to AVINYA, a one-of-its-kind Edufest brought to you on March 11 by @official_ibab on its campus in Bengaluru. Exciting events, yummy food, attractive prizes, cutting-edge research - all of these are up for grabs! To register: ibab.ac.in/avinya2023
I stumbled upon in silico research. During the pandemic, it was the most feasible way to finish my degree on time. Luckily for me, it opened a whole world of skills. #bioinformatics #biologicaldata #programming #statistics #biology #onlinelearning maiaenriquez.com/2023/03/06/lea…
Right now: You know it's cold out when.. Windmill Road Dartmouth between both bridges, opposite the shipyard not that it can be seen through the seafog. (Thanks Amy!)
Do interpersonal relations shape the individual genetic makeup of the microbiome and its transmission within and across populations?
Do interpersonal relations shape the individual genetic makeup of the microbiome and its transmission within and across populations?
Inner Mongolian Gut Genome catalogue. nature.com/articles/s4156…
"In zebrafish without those gut microbes, the pruning didn’t happen, and the fish showed social deficits." scitechdaily.com/scientists-unc…
IBAB's Bio-IT Centre is conducting an in-person hands-on #workshop on “RNA library preparation, RNA Sequencing analysis with R” from Dec 26-30 2022. To find out how to apply, visit ibab.ac.in/hands-on-onlin… Deadline to apply: 15 Dec (25 seats) @ITBTGoK @KbitsMd @Ktech_biotech
Circadian Rhythms, the Gut Microbiome, and Metabolic Disorders ow.ly/W08T50LOYmi
Mysterious Tendrils Inside The Brain May Control Our Perception of Time bit.ly/3FndrVB
BREAKING NEWS: New #Alzheimer drug #Lecanemab slows cognitive decline (18-month change in CDR-SB) by 27%, drastically lowers brain amyloid load by 59 centiloids to 23 (below PET amyloid positivity)! NEJM paper: nejm.org/doi/full/10.10… prnewswire.com/news-releases/… #CTAD
Making a heatmap is an essential skill for a bioinformatician. But you probably do not understand heatmap. 7 reading resources to understand heatmap!👇🧵 compiled at crazyhottommy.blogspot.com/2022/11/7-link…
Separating the contribution to host health benefits made by postbiotics already present in probiotic products is not straightforward. Are bacterial extracellular vesicles the future postbiotics? gutmicrobiotaforhealth.com/bacterial-extr…
Why the microbiome is an important mediator of nutrition’s impact on the gut-brain axis? This in-depth interview from @harschellekens, @RibeiroCR_Gabri, @Cristinacuestam & @jfcryan updates what we know in this amazing field ow.ly/wFYb50LaW3h
"Automated contig clustering with cluster assessment using lineage-specific marker gene sets" Another one for the MAGs!
"Automated contig clustering with cluster assessment using lineage-specific marker gene sets" Another one for the MAGs!
Machine learning and deep learning applications in microbiome research @ISMEJournal New review article discussing how artificial intelligence methods are being applied to analysis #microbiome data. #bioinformatics #microbiota nature.com/articles/s4370…
Some advocate for transplanting younger poop into the old. We suggest that it may not be optimal to 'turn back the clock' when it comes to healthy aging in the gut. 💩⚕️🧓 Check out our commentary in @NatureAging rdcu.be/cWrT0 @TWilmanski @ISBNathanPrice @isbsci
Gaurav Sharma, Ph.D. @sharmaG30
3K Followers 1K Following Assist. Prof. @IITHyderabad🇮🇳 | Delving into microbial/plant genomics & evolution with @omics_lab | 🎯Work-life balance. Family👨👩👧. Runner | Wordplay
John F. Cryan @jfcryan
22K Followers 7K Following Vice President for Research & Innovation @ucc @UCCResearch @UCCInnovation| PI @pharmabiotic| Prof @AnatNeuroUCC| MRIA @RIAdawson| Bluesky @jfcryan.bsky.social
Sophien Kamoun @KamounLab
38K Followers 29K Following Biologist at The Sainsbury Lab; passionate about plant pathogens and evolution; open science advocate; loves travel, food and sports; nomad and hunter-gatherer.
The Struggling Scient.. @TheStrugglingS4
52K Followers 23K Following 🤩Science & PhD Life Podcast 🎙️Episodes 🤣PhD Memes 👕Science inspired Merch 📰PhD related Blogs
Avinash Sharma @SharmaAavi
2K Followers 627 Following Scientist @DBT_NCCS_Pune| @India_Alliance Fellow. Past: Visting Scientist @Leibniz_DSMZ_en @BHT_bln @NotreDame | TWAS Visiting Expert @UNJ_Official
Rakshak Kumar Acharya @RakshakKumar
1K Followers 1K Following Environmental Microbiologist at CSIR-IHBT, Palampur #IndianHimalaya #Bacteria. Sports lover and a proud #Gorkha from #Assam. Works at @hamlab_ihbt
Dr. Ashwini Kumar �.. @aktilaiyan
3K Followers 3K Following Sainik School Alumnus // Ph.D. (Biotechnology) // Assistant Professor & Scientist // Biomaterials, Drug Delivery, Diabetes // राष्ट्र सर्वोपरि, सर्वदा
Karishma Kaushik, MBB.. @_KarishmaK
23K Followers 6K Following Executive Director | @IndiaBioscience 🇮🇳 Physician | Scientist | Clinical Microbiologist | Hockey India | Sarees | Hindi Movies | Filter Coffee and Jalebi
Jonathan Jacobs 🧬�.. @bioinformer
9K Followers 3K Following Authenticity and data provenance in #genomics + #bioinformatics. Also #scicom, @officialATCC #gaming #DnD #EDM #punk @ Home ♟👾🎮 🎸he/him
Michelle Roche @MRocheLab
814 Followers 883 Following Neuroscientist and Associate Professor in Physiology at University of Galway. Mother of 2 crazy kids. The views expressed and comments are personal opinions.
Kumar Sankaran @BiomeSankar
819 Followers 587 Following Earthling! Holobiont!! Specialising in being a generalist Company - @LeucineRichBio Product - @BugSpeaks #FaustianBargain #Microbiome
Dr. Harriet Schelleke.. @harschellekens
2K Followers 2K Following Lecturer @AnatNeuroUCC | Funded Investigator @Pharmabiotic #Gut-Brain-axis, #Obesity #FoodReward, #Appetite, #Mood, #Ghrelin, #GPCRs. #FirstGen, #AcademicMom
Sirtau @Sirtau2_AlG
0 Followers 94 Following
Flick_Fiesta @FiestaFlic9390
40 Followers 2K Following
Michelle Reed @MichelleRe49604
19 Followers 752 Following
Mariah13 @Mariah192735460
35 Followers 2K Following
Renee_US_ @ReneeU22353
22 Followers 2K Following
Addys 🍭 @Addys9512
0 Followers 216 Following Fiery nуmpho sееks passiоnаtе аnd fulfilling intеrасtiоns
Base_Style_ @BaseStyle111952
17 Followers 2K Following
Hazel @Hazel6495250045
28 Followers 2K Following
Retheateigh @retheateig68591
29 Followers 2K Following
470hv6zm2n2kzqvd @61y7s3u5xvf1wg
1 Followers 273 Following If you want to make friends, you can contact me anytime TG：https://t.co/kkELK2mViA WS：https://t.co/wGpT1UCvSO
Aubrey @Aubrey1856231
22 Followers 2K Following
u83n3pk16h1 @byf4oyhnbp3hwh
5 Followers 199 Following If you want to make friends, you can contact me anytime TG：https://t.co/QjX8sUt61K
gK @philentropist
2 Followers 3 Following
Carly @Carly1334815
19 Followers 2K Following
HRM FireWire @HRMFire_Wire
168 Followers 93 Following Not Affiliated with Fire or Emergency Service's
Katie Miller @KatieMi30965424
114 Followers 3K Following
Seeshe @Seeshe776008
66 Followers 2K Following
Lindsay @campbell_lindsa
114 Followers 3K Following
Meetot @Meetot177481
42 Followers 2K Following
Stuseseigh @stuseseigh40782
73 Followers 2K Following
Samantha_Th @SamanthaTh24179
4 Followers 459 Following
Thosis @Thosis334064
81 Followers 979 Following I'm new to Twitter accounts so I tried the messaging feature and it's great to meet you.
Biswabijaya Samal @biswa_bijaya
195 Followers 463 Following Tech @enigmagenomics Software Engineer | Problem Solver | making a difference!
Rob Lalonde @HPC_Cloud_Rob
4K Followers 5K Following CCO at @SeqeraLabs / @nextflowio Doing cool #Nextflow infrastructure stuff in #bioinformatics. Helping startups with going to market. Tweets are my own.
Andrea Zanchini @zanchini_a58786
92 Followers 6K Following
Jessica Smith @JessicaSmi81645
123 Followers 3K Following
Beessee @Beessee340673
210 Followers 4K Following
Becky @beckydewoody43
192 Followers 3K Following
McThoare @MThoare63806
43 Followers 1K Following
Courtney @mcdonald_courtn
127 Followers 3K Following
Cori @lee_cori11
103 Followers 3K Following
Valentino Werner @ValentinoW70153
161 Followers 3K Following
Meghana Janardhanan @_meghana_j
361 Followers 565 Following PhD Student @DalhousieU Medical Neuroscience | Psychiatric Genetics | She/her
Goldie @jones_goldie31
214 Followers 3K Following
Patricia @patricia94tanzo
193 Followers 3K Following
Madhushruti Borah @Madhushruti_B
22 Followers 103 Following JRF @IbabSynbio | Synthetic Biologist 👨🔬 | Molecular Biologist 🧫 | CRISPR 🧬 | Sciart 🎨 | Masters @official_ibab | Alumnus @CottonUniversi1 | She/Her
DeviAyyagari @devi_ayyagari
6 Followers 43 Following
Mildred @krawiec_mildred
164 Followers 3K Following
Barbara @barbara72do
154 Followers 3K Following
Louise @louise_carter66
163 Followers 3K Following
Guy R + Scifind.io @grohkin
1K Followers 5K Following Co-Founder of https://t.co/Y3t9XLCu8k (@sci_find). Molecular Biologist from @IndBio/@Girihlet. Building community to troubleshoot scientific problems #OpenScience 🏳️🌈 🧬
Urvashi Kushwah @I_am_Urvashi
49 Followers 551 Following Seeking PhD position | Interested in Musculoskeletal diseases research | #firstgenstudent | Alumni #Jiwaji Univ. @IGIBSocial @Official_ibab
PostdocVoice @PostdocVoice
31K Followers 20K Following Amplifying the voices of Postdocs. Tag us with #PostdocVoice or @PostdocVoice. Run by @PhDVoice. Independently Run. How To Write An Academic Paper 101 link👇
Anjani Gopal @anjani_gopal
17 Followers 158 Following Doctoral student @CNRS l LPHI - Université de Montpellier #parasitology #WomenInMalaria #WomenInSTEM
Asha Inbanathan @Asha_Inbanathan
0 Followers 1K Following
ਅਮਰਿੰਦਰ.. @amarinder_thind
151 Followers 473 Following Bioinformatics | Data Science | Marie Curie Alumni MCAA | 📊| Nature |🍀 | Hiking | 🥾 | 📷 Volleyball | 🏐| All views are my own
Institute for Compara.. @ICG_Dalhousie
60 Followers 58 Following ICG is a @DalhousieU Institute of researchers and trainees in Medicine, Science, Computer Science and Agriculture
Jyotika Pachauri @PachauriJyotika
93 Followers 429 Following Doctoral Student - LSC Vilnius University, Lithuania || Computational Biologist || Machine learning || Structural Bioinformatics
Ali khan @Alikhan64776532
2 Followers 21 Following
Gaurav Sharma, Ph.D. @sharmaG30
3K Followers 1K Following Assist. Prof. @IITHyderabad🇮🇳 | Delving into microbial/plant genomics & evolution with @omics_lab | 🎯Work-life balance. Family👨👩👧. Runner | Wordplay
Oded Rechavi @OdedRechavi
139K Followers 1K Following Don't be fooled by the rocks that I got, I'm still Oded from the block. TED: https://t.co/rcOm9TSTf5 Huberman Lab Podcast: https://t.co/xZTNlx9nbi
The Nobel Prize @NobelPrize
1.1M Followers 509 Following The official Twitter feed of the Nobel Prize @NobelPrize #NobelPrize
GutMicrobiota Health @GMFHx
35K Followers 3K Following Gut Microbiota for Health by experts, for experts from medical & scientific communities. By https://t.co/bGngsUpgkM #GMFH2024 #health #microbiota #gutmicrobiota
John F. Cryan @jfcryan
22K Followers 7K Following Vice President for Research & Innovation @ucc @UCCResearch @UCCInnovation| PI @pharmabiotic| Prof @AnatNeuroUCC| MRIA @RIAdawson| Bluesky @jfcryan.bsky.social
Academic Chatter™ @AcademicChatter
273K Followers 981 Following Join #AcademicChatter for support & community. Team: @waterlego @Heather_RoseW.
APC Microbiome Irelan.. @Pharmabiotic
11K Followers 3K Following Global leader in microbiome science | Science Foundation Ireland Research Centre @scienceirel @ucc @teagasc | #BelieveinScience #MicrobiomeIreland
María R. Aburto @isen_gard
2K Followers 2K Following Group Leader @Pharmabiotic | Senior Lecturer @AnatNeuroUCC |Gut microbes & Neurovascular development |Member @YoungAcademyIrl @maburto.bsky.social
Poonam Thakur @poonam_thakur6
9K Followers 2K Following Assistant Prof @tvmiiser & @India_Alliance fellow. Interested in the neuroscience of Parkinson's disease. Now on https://t.co/OZExaDgDbX
Jen Heemstra @jenheemstra
101K Followers 14K Following Professor and Chair of @WashUChem, proud member of @HeemstraLab. I'm a researcher, but I'm a #MentorFirst. Tweets mine.
Katie Guzzetta 🌻 @ktguzz
5K Followers 1K Following All things #Microbiota-#Gut-#Brain Axis!👩🔬💩 Postdoc w/ @randall_platt @ETH_BSSE🇨🇭 Formerly @HamiltonCollege🇺🇲 ➜ @Pharmabiotic🇮🇪 ➜ @harvardmed
eLife - the journal @eLife
163K Followers 744 Following The funder-researcher collaboration and open-access journal for research in the life and biomedical sciences | @eLifeCommunity
Serena Boscaini @SerenaBoscaini
890 Followers 459 Following Italian🇮🇹 post-doctoral researcher at APC Microbiome Ireland 🇮🇪. Interested in microbiome, nutrition & health, metabolism, mental health.
Avinash Sharma @SharmaAavi
2K Followers 627 Following Scientist @DBT_NCCS_Pune| @India_Alliance Fellow. Past: Visting Scientist @Leibniz_DSMZ_en @BHT_bln @NotreDame | TWAS Visiting Expert @UNJ_Official
Rakshak Kumar Acharya @RakshakKumar
1K Followers 1K Following Environmental Microbiologist at CSIR-IHBT, Palampur #IndianHimalaya #Bacteria. Sports lover and a proud #Gorkha from #Assam. Works at @hamlab_ihbt
Bengaluru Weather @BngWeather
31K Followers 155 Following Bengaluru/Bangalore weather updates and status from a group of weather crazy enthusiasts! Disclaimer - No affiliation to any official agency.
Salim T. Islam Resear.. @IslaMyxoLab
319 Followers 352 Following Extracellular Bacterial Interactions Lab at @inrsciences Our favourite bug? Myxococcus xanthus, "the E.coli of development" #myxo
Dr. Ashwini Kumar �.. @aktilaiyan
3K Followers 3K Following Sainik School Alumnus // Ph.D. (Biotechnology) // Assistant Professor & Scientist // Biomaterials, Drug Delivery, Diabetes // राष्ट्र सर्वोपरि, सर्वदा
Yvonne Nolan @yvonnemnolan
2K Followers 672 Following Vice Dean of Graduate Studies @uccMedHealth Professor in Neuroscience @ucc Research on ageing, brain plasticity and behaviour @AnatNeuroUCC Mother of Boys
Vega Shah @dr_alphalyrae
12K Followers 3K Following life sciences software 🧬 product strategy 👩🏻💻 writer & futurist 🚀 previously scientist at @JGI, @UW & @UCBerkeley 👩🏻🔬 views are all mine ✨
Support Our Science @SupportOurSci
2K Followers 586 Following #SupportOurScience is a grassroots organization advocating for better grad student and postdoc pay in Canada through increased federal investments
Paul Vienneau ♿️ @paulvienneau1
2K Followers 2K Following Halifax Photog, Photos at https://t.co/vkHpmow6Uh Mentalist. QEII Platinum Jubilee Award recipient! ShovelCorp Industries
Government of Karnata.. @governmentofkar
3K Followers 0 Following
Vanderbilt Cell and D.. @VanderbiltCDB
855 Followers 147 Following News, Publications, Upcoming Seminars, and More from our Talented Scientists in the Department of Cell and Developmental Biology @VanderbiltU @VUBasicSciences
Zebrafish Development.. @ZebraFishLab
433 Followers 133 Following ZDG Lab at IIMCB, Warsaw, Poland. We study developmental processes by applying genomics approaches in zebrafish model organism.
gK @philentropist
2 Followers 3 Following
Wei-Peng Teo, Ph.D., .. @ThisistheWei
680 Followers 812 Following Exercise neuroscientist; Motor control and development researcher; Neuroplastician; Views are my own..
Indian Tech & Infra @IndianTechGuide
472K Followers 36 Following Everything about Indian technology, infrastructure, and economy. The opinions expressed here are strictly personal. Insta: https://t.co/E9dK2T0y5q.
Vicky Pedia @Vickypedia_007
20K Followers 54 Following
Project Encephalon @prjctencephalon
2K Followers 367 Following Project Encephalon (PE) is an international, trainee-led non-profit organization for neuroscience enthusiasts. Also at- https://t.co/hYqW9jAbA1
The Science Paradox @Science_Paradox
320 Followers 35 Following E-magazine in Science - Run by a bunch of grad students advocating the communication of Science Sans Barriers!
Anushree Krishnamurth.. @AnushreeKMurthy
833 Followers 1K Following Exploring the gut-brain axis in Parkinson’s Disease @AarhusUni_int • Co-founder @Science_Paradox • Ex-VP @prjctencephalon • Sci-commer
Meghana Janardhanan @_meghana_j
361 Followers 565 Following PhD Student @DalhousieU Medical Neuroscience | Psychiatric Genetics | She/her
10ThingstoKnowAbout @10Things_ToKnow
3K Followers 479 Following Six part series on RTÉ One, showcasing the best in Irish scientific research.
Friederike Uhlig @fuhlig273
252 Followers 294 Following
UQ News @UQ_News
96K Followers 3K Following News, events and discoveries at The University of Queensland. Monitored during business hours. CRICOS Code 00025B. TEQSA PRV12080. Guidelines: https://t.co/vggTvydh55
Mater Research @MaterResearch
1K Followers 218 Following Mater Research collaborates across a growing network of partners to turn scientific discovery into the best health outcomes for our community. Monitored 9-5 M-F
QCMHR @QCMHR
847 Followers 294 Following The Queensland Centre for Mental Health Research is a premier mental health research facility, concerned with reducing mental health disability.
Queensland Brain Inst.. @QldBrainInst
7K Followers 645 Following Working to understand the development, organisation and function of our amazing brains in health and disease. 👇👇 Newsletters: https://t.co/Uj4rkaqX9O
Svetlina Vasileva @sunsvet23
503 Followers 666 Following PhD candidate at the @QldBrainInst 👩🏼🔬she/her🇧🇬 Studying the #gut_microbiome in #schizophrenia and #treatment. Advocate for 🧠 and 🌏 health. 🌏✊🏻🧗♀️💃
Dr Samantha Dawson @_SamanthaDawson
502 Followers 270 Following Bioinformatician, Nutritionist (and triathlete) researching the perinatal diet and gut microbiota in mothers and infants @foodmoodcentre @Deakin.
Dr Amy Loughman @MBmicrobiome
2K Followers 594 Following psychologist | neuroscientist | mapping the gut-brain-microbiome axis | designing better spaces for work
Helen Macpherson @DrHelen_Mac
2K Followers 2K Following Researcher cognitive neuroscience, dementia prevention through diet and exercise. Mum x 2 toddlers. Podcaster @_bloomingbrain Founder https://t.co/Vri4uNXUF5
Dr. Nathan Nuzum (he/.. @nathnuz
667 Followers 1K Following Post-doc Fellow @UCC investigating the gut-brain axis in depression. PhD completed @Deakin in Parkinson’s, brain stim & gut brain axis 🦠🧠. Views are my ownⓋ
The Coast - Halifax/K.. @TwitCoast
96K Followers 3K Following Making the #Halifax scene since 1993. Once as a weekly paper, now as a daily newsletter 🗞 Subscribe to The Coast Daily 📩 ⬇️
Halifax Transit Alert.. @hfxtransitalert
7K Followers 2 Following Halifax Transit alert feed. This is an automated feed of detours and closures. Account is not monitored.
Mason @Jackfarm15
6 Followers 29 Following
Build Nova Scotia @BuildNovaScotia
21K Followers 2K Following We are Build Nova Scotia, working with Nova Scotians to build places and infrastructure that drive our economy forward for all Nova Scotians.
Nova Scotia Legislatu.. @NSLeg
17K Followers 375 Following Official updates from Province House, Canada's first legislature. Social media guidelines: https://t.co/pShCqbgUCi. LTV guidelines for use: https://t.co/ADucerRbrt
ECCC Weather Newfound.. @ECCCWeatherNL
4K Followers 12 Following Canada’s official weather and climate source. Tweets by @environmentca meteorologists. Suivez-nous en français @ECCCMeteoNL Terms: https://t.co/hYp1hBXnSr
ECCC Weather New Brun.. @ECCCWeatherNB
3K Followers 1 Following Canada’s official weather and climate source. Tweets by @environmentca meteorologists. Suivez-nous en français @ECCCMeteoNB Terms: https://t.co/cwNSBOC7OO
ECCC Weather Prince E.. @ECCCWeatherPE
1K Followers 2 Following Canada’s official weather and climate source. Tweets by @environmentca meteorologists. Suivez-nous en français @ECCCMeteoPE Terms: https://t.co/TiqYoSdDYL
Health & Wellness @nshealth
34K Followers 450 Following Official tweets from Nova Scotia's Department of Health and Wellness
NS Environment and Cl.. @ns_environment
8K Followers 697 Following This account highlights the activities of Nova Scotia Environment and Climate Change. For environmental emergencies call 1-800-565-1633.
ECCC Weather Alberta @ECCCWeatherAB
8K Followers 75 Following Canada’s official weather and climate source. Tweets by @environmentca meteorologists. Suivez-nous en français @ECCCMeteoAB Terms: https://t.co/4wvyWTWywQ
ECCC Weather Ontario @ECCCWeatherON
38K Followers 143 Following Canada’s official weather and climate source. Tweets by @environmentca meteorologists. Suivez-nous en français @ECCCMeteoON Terms: https://t.co/z6ZbOF7eWP
The Sheridan Sun @TheSheridanSun
1K Followers 241 Following Weekly news production on our online newspaper and news show. Created by Sheridan College's Journalism program.
Nathan Howes TWN @HowesNathan
7K Followers 5K Following Digital reporter at @weathernetwork. Former @MetrolandMedia reporter, @TheSheridanSun editor. @SheridanCollege print-journalism graduate. [email protected]
Instant Weather Atlan.. @IWeatherAC
47 Followers 10 Following Atlantic Canada’s independent and community-driven weather organization. Download our app: https://t.co/jIDYaI50i8
Pete's Frootique & Fi.. @PetesNS
12K Followers 1K Following Locally-loved, award-winning market with a taste of old world charm. Friendly & knowledgeable staff serve up top notch food.
Andy Fillmore, MP �.. @AndyFillmoreHFX
17K Followers 5K Following Member of Parliament for Halifax. City planner. 🇨🇦
Matthijs Dorst @MattNeuro
4K Followers 3K Following Neuroscientist. Recovering patcher, former editor, bumbling imager. Perpetually baffled. Now almost exclusively on BlueSky - https://t.co/IKPAO9nXVa
Fabric Genomics @FabricGenomics
3K Followers 2K Following Fabric Genomics - AI‑Driven Clinical Insights for Genomic Data
NWS OPC @NWSOPC
26K Followers 285 Following Official Twitter account for the National Weather Service Ocean Prediction Center. Details: http://t.co/KKTK7cZlhK
Storm Track USA @atlanticstorms
171 Followers 32 Following This is the place for all of your Atlantic, Pacific, and Gulf Storm Warnings. A quick way to see the status on all Hurricanes. Updated often!
Firefighters of Nova .. @FireFNS
6K Followers 295 Following Firefighters of Nova Scotia strives to keep Nova Scotians up to date with the latest fire service news in the province!
Year Progress @year_progress
716K Followers 0 Following The only progress bar you'd rather see go slower.
ANI @ANI
8.2M Followers 0 Following Asian News International. Multi-media news agency, content for information platforms: TV, Internet, broadband,newspapers, mobiles https://t.co/eEMPAbAcms
Tim Hayes 🇨🇦�.. @TimoMajere
702 Followers 517 Following ex?-Video game developer/modder Sporadic voice over artist. Improv comedian. Critical Thinker. Google 'TimoMajere'. I think I may be leaving forever soon.Wrapped up & submitted 2 works on @biorxivpreprint: 1. Led by @official_ibab PA (@MurthySneha) on Priestia comparative genomics: biorxiv.org/content/10.110… 2. Led by IBAB MSc student (Shruti Jain) on Myxococcus plasmid evolution: biorxiv.org/content/10.110… Publication pilgrimage is ON.
AATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAGAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAAAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTGA
We have just isolated a brand new probiotic, Lactobacillus aprilli. Amazing gut-brain activity!! It helps one and all decipher messages that comes in April
Not every day one can see #JRRTolkien cited in a scientific review 🤓 “Still round the corner there may wait A new road or a secret gate And though I oft have passed them by A day will come at last when I Shall take the hidden paths...”
The three musketeers still at it. Conquering the microbiome world one sample at a time.
Asking @deb_iisc to keep abreast with latest research on the microbiome & this is what he finds
Ok, let this sink in for a second. Microbiota 🦠 can affect colonic motility and circadian rhythm in the gut through the production of substances like short chain fatty acids. That's almost like bacteria determining when your gut moves 💩 🔓frontiersin.org/articles/10.33… #GITwitter
I have to dance on this while you sing it beta. And if I get the step wrong you instantly change the rhythm so I look good! U can do magic like that I know….love u.
It’s been a while.. here’s your fav #Chaleya ❤️ @iamsrk @Atlee @RedChilliesEnt @TSeries
IBAB is organising a 3-day, hands-on @Workshop in offline mode on “Introduction to Machine Learning in Genomics” from Sep 21-23, 2023. Maximum intake is 25 participants on a first-come basis. Registration deadline is Sep 14, 2023. To register: docs.google.com/forms/d/1JpbTq… @DBTIndia
Pakistani have underestimated Nepali fielding 😜 #PAKvsNEP
@KnightLabNews (@UCSDMedSchool / @UCSDJacobs) is excited to announce a new release of Greengenes in @NatureBiotech (nature.com/articles/s4158…). With this release, we provide a single taxonomy and phylogeny unifying 16S and shotgun metagenomic analyses! A thread (1/n)
I've used this a bunch now and it's much faster than the original. Glad for the update and to see it finally published! CheckM2: a rapid, scalable and accurate tool for assessing microbial genome quality using machine learning nature.com/articles/s4159…
Gut microbiome composition may be an indicator of preclinical Alzheimer’s disease | Science Translational Medicine science.org/doi/10.1126/sc…
We are excited to announce the acceptance of our review on gut-brain axis in multiple sclerosis and stroke, onlinelibrary.wiley.com/doi/10.1002/ej… led by @LauraDzMa from my lab!
4am thunderstorms are just cruel
Gut-Brain Axis - the most recent advances on the role of the microbiome in early-life, aging, cognition and much more - from @niall_hyland and Prof Catherine Stanton @Pharmabiotic @MicrobeTweets @UCCResearch 2nd edition available to pre-order here shop.elsevier.com/books/the-gut-…
Applications are invited for Software Engineer – Full Stack Developer position(s) @official_ibab The successful candidate will work on developing software platforms & products for education, research & administration. For more details, visit: ibab.ac.in/careers/softwa… @ITBTGoK
@official_ibab seeks to appoint a faculty member in the area of Computational Biology with a strong focus on Genomics and analysis of NGS data using AI/ML for its innovative Masters Programme in Big Data Biology. For more details, visit: ibab.ac.in/careers/facult…
Taught my son this rhyme today and he stopped jumping on the bed. "5 little monkeys jumping on the bed 1 fell off and broke his head Mama called a doctor and doctor said No more monkey cause he's dead."
Trends for United States
You might like
