Debasish Boral @dboral
Dad, chef, scientist ... trying to make a better world! Philadelphia, PA Joined October 2010-
Tweets469
-
Followers105
-
Following116
-
Likes773
Hey @Rt18CJDR just wanted to tell you that advertising a price and then asking $2000 on top as “dealer conditioning fee” is plain stupid!
Despite appearing vastly different, many diseases share underlying mechanisms that existing medicines can treat. Take thalidomide, a drug that tragically caused severe birth defects in the 1950s. Decades later, it emerged as a key treatment for leprosy and multiple myeloma. At…
Greatest one day innings I’ve ever seen. Take a bow @Gmaxi_32! Now I know what it must’ve felt like in that match against Zimbabwe @therealkapildev #AUSvAFG #WC2023
Stupidity at a whole new level. Why do we Indians obsess with demigods and opening ceremonies and centuries? #ViratKohli #WC2023
BREAKING: The Philadelphia PD has just released this footage from a store in Northeast Philly called Richard & Son. These actions can NEVER be justified, and I think it's fair to say that the vast, vast majority of Americans agree that this type of behavior should be dealt…
🔥🔥🔥 This is the most damning thing I've seen on $TSLA Autopilot/FSD. Amazing footage from both the car's camera and police dashcams. I can't see how anyone could buy/hold $TSLA and sleep at night. $TSLA is worth $0 if regulators shut AP/FSD down. wsj.com/video/series/i…
BREAKING: The CEO of @Hertz wrote a letter to Puerto Rico‘s representative in Congress stating that Hertz has rewritten its policy to make it abundantly clear that Puerto Rico is a U.S. territory - not a foreign country - & because of that Puerto Rico driver’s licenses are not…
Ohio on Monday filed a lawsuit accusing Cigna Group , Humana Inc and others of colluding to drive up prescription drug prices by charging exorbitant fees for pharmacy benefit management services. reut.rs/3lHwWBs
My God -@therealkapildev really didn’t like Srinivas Venkataraghabhan bossing him around (at least if story is to be believed) google.com/amp/s/wisden.c…
Another bank fails #signaturebank federalreserve.gov/newsevents/pre…
Translation: The lawyers called
We carried out the first infusion of CAR T-cell in Brazil after approval by ANVISA (regulatory agency of Brazil). Cell therapy arrives in Brazil! We still have many challenges ahead but always aiming for the best for people!
I obtained surveillance footage of the self-driving Tesla that abruptly stopped on the Bay Bridge, resulting in an eight-vehicle crash that injured 9 people including a 2 yr old child just hours after Musk announced the self-driving feature. Full story: theintercept.com/2023/01/10/tes…
The benefit of CAR T cells targeting both CD19 and CD20 in relapsed/refractory Non-Hodgkin #lymphoma. Also highlights the utility of transducing CD62L+ naïve and memory T (TN/MEM) cells. #CellTherapy #Immunotherapy #CancerResearch doi.org/10.1158/2159-8…
Our report of first-in-human GPRC5D-targeted CAR T cells for MM is out in NEJM! The trial was led by Sham Mailankody and could not be done without the amazing clinical, correlative science, stats, & cell manufacturing teams. Happy to share our bench>bedside journey 1/10
Attacking #lymphoma apoptosis resistance w venetoclax *plus* armoring CAR T cells to venetoclax toxicity: Modulation of BCL-2 in both T Cells and Tumor Cells to Enhance Chimeric Antigen Receptor T cell Immunotherapy vs Cancer @PennMedicine @MarcoRuella aacrjournals.org/cancerdiscover…
Great work @OxDmitrieva. Far greater things on the way!
Great work @OxDmitrieva. Far greater things on the way!
"This is why non-immunologists hate immunologists..." The fantastic @EJohnWherry explains the basics of cancer immunology with a focus on T cells in his beautiful and extremely clear lecture @AACR #AACR22. I really recommend watching it, it's a gem - both in content and delivery.
Soyses @Soyses173068
4 Followers 292 Following
Thismodurn @thismodurn25791
0 Followers 345 Following
Seyturpey @seyturpey79280
0 Followers 312 Following
Grartio @grartio14918
0 Followers 309 Following
Naywe @Naywe324199
0 Followers 101 Following
CoralBack @4qcZ4E6AmU8UD3
0 Followers 141 Following
Stilun @StilunxoKp
0 Followers 72 Following
うらなみまなみ @uranamiman51625
0 Followers 87 Following
Colleen @hinasea9777179
5 Followers 935 Following
Tunairth @Tunairthh7SfWr
0 Followers 297 Following
EileenDupont @U6TZeNJdfPurw83
5 Followers 311 Following
Cheyllewr @Cheyllewrab6fY
0 Followers 152 Following
Tuthirtor @Tuthirtorko32N
0 Followers 233 Following
Sleaphough @sleaphough43030
3 Followers 338 Following
Sirsloy @SirsloykOc4VmE
0 Followers 292 Following
Thena @Thena7031187345
12 Followers 385 Following A strong woman is one who is determined to do what others are determined not to do.
Reyssoa @Reyssoah0aH
5 Followers 157 Following
AlmaQuiller @AtH6O9GwlBkCr6
0 Followers 165 Following
MavisBright @Uxr3Jv16Tn1y7
0 Followers 306 Following
Janene Pellissier @PellissieJane
84 Followers 5K Following
JoanneWood @461CsmjktBW5ixT
1 Followers 293 Following
Toustoez @ToustoezhTE
0 Followers 303 Following
AlbertaDobbin @78aQgUkMLvd5zs
1 Followers 312 Following
Faysleau @faysleau52322
1 Followers 391 Following Life itself is a journey, we are all worthy and should strive to travel to different lives.
Doylas @Doylas7omZYH1
0 Followers 295 Following
Seynitteighr @seynitteig30068
8 Followers 382 Following
vw932bwaggd @3o3ia0h7erbo9c
1 Followers 777 Following
Gracie-may Aguilera @aguil_gracie
59 Followers 5K Following
Famous @carey_cynt99792
3 Followers 397 Following
Helena Golombecki @HGolombeck89170
110 Followers 5K Following
Ondina Orn @OndinaOrn81350
74 Followers 5K Following
Thoatey @Thoatey152418
20 Followers 1K Following
PixelPop @PixelPop57125
18 Followers 272 Following
Elon Musk Private Pag.. @privateelonpag
47 Followers 2K Following
Tetee @Tetee3582829846
59 Followers 2K Following
Ketagea @ketagea94901
18 Followers 2K Following
Sheandeh @sheandeh92680
185 Followers 3K Following
Beysha @Beysha177066
7 Followers 562 Following
Seene @Seene543339
79 Followers 2K Following
Tharemmet @tharemmet37377
155 Followers 4K Following
charlotte @charlot66929057
18 Followers 2K Following
Sara Ballagh @SarBallag
55 Followers 5K Following
Arfa Vendelin @AVendelin11488
47 Followers 5K Following
Noodeigh @noodeigh54863
157 Followers 2K Following
So_ursop7 @ursop798941
3 Followers 100 Following
Craig Shapiro @ces921
16K Followers 1K Following Macro Trader 20+ years, Founder of The Alethea Narrative: Seeking Truth in Financial Markets through Narratives, Macro Advisor LaDuc Trading
Triple Net Investor @TripleNetInvest
89K Followers 723 Following Investor, Real Estate Entrepreneur, ex Investment Banker | Breaking News: Real Estate, Finance | Sharing Advice From Successful Entrepreneurs & Investors
STREET MEDIA TV @streetmediatv
307K Followers 584 Following VIRAL TIMELINE! JOIN THE CONVO! DON'T FORGET TO TURN ON NOTIFICATIONS! 🔔 WEBSITE ↘️
Untamed Human Race @FunnyHumanRace
74K Followers 53 Following The Good The Bad and The Ugly of our race. Turn Notifications On 🔔. Road to 80K followers 🫶
Geoffrey Fouvry @GraphFinancials
6K Followers 168 Following Connect the Financial dots Docs, Imgs, texts, Vids linked by big-data Present, reply in augmented media US Patent approved. ex hedgie 👇 get your free account
Danny Dayan @DannyDayan5
11K Followers 211 Following Ex Hedge Fund Manager; Global Macro Volatility Portfolio Manager. Chicago Booth MBA & CFA. My views do not consist of investment advice.
Brian Sullivan @SullyCNBC
164K Followers 2K Following CNBC Anchor 7pm ET. 28 year business journalist. Storyteller. Auto racer. Hokie. Believer in science, data & facts. Question everything.
unusual_whales @unusual_whales
1.7M Followers 2K Following Stocks/Options/Crypto/Market News +Tools. Not advice 🐳 who changed 🏛️. Get $50-$5000 to trade: https://t.co/wGf2ZdlXpw Discord: https://t.co/0xJ9e0ZYYG More: https://t.co/nsxZlPV0pC
Porter Stansberry @porterstansb
12K Followers 428 Following Finance Hack. Chairman of Porter & Co. Founder of MarketWise (NASDAQ: MKTW), a leading publisher of independent financial research.
David Fajgenbaum, MD @DavidFajgenbaum
11K Followers 3K Following @Penn physician-scientist-patient who 'cured thyself' | Advancing @CureCastleman + @EveryCure | National Bestseller #ChasingMyCure https://t.co/26OS13etrF
Bertrand Delsuc @BertrandBio
16K Followers 251 Following Views=mine only, RT-like=/=endorse, no advice. 16y in Tech (chip design) & a bit of Bio :)
Bootsie @bootsiejones
14K Followers 781 Following The market always goes to the price that hurts the most people. The market does not know your price. This is not advice; Do your own homework... and use stops.
Richard Field @tyillc
11K Followers 5K Following Director Institute for Financial Transparency Author of Transparency Games RT not endorsement
Kashyap Sriram @kashyap286
13K Followers 508 Following Trader/Analyst | Ex - AAO Research, Independent Speculator, The Dollar Vigilante, Value Research Online. Gold, shipping, energy, crypto, tech. MBA - IIT Madras
Grizzly Research @ResearchGrizzly
50K Followers 457 Following Grizzly Research LLC is focused on producing differentiated research insights on publicly traded companies through in-depth due diligence.
Lawrence H. Summers @LHSummers
327K Followers 706 Following Charles W. Eliot University Professor and President Emeritus at Harvard. Secretary of the Treasury for President Clinton and Director of NEC for President Obama
Michael Burry @michaelburry
21K Followers 1 Following Please visit http://t.co/ImtCNRu6mb to learn and discuss about value investing!
Robin Brooks @robin_j_brooks
307K Followers 211 Following Senior Fellow @BrookingsInst, previously Chief Economist @IIF and Chief FX Strategist @GoldmanSachs. Opinions are my own. Email: [email protected].
The Long Investor @TheLongInvest
62K Followers 735 Following Airline Captain, B.A. in International Business & Economics, Law Diploma, Technical & Financial Analyst. Not Financial Advice. Patreon: thelonginvestor
dmac @dana_marlane
36K Followers 279 Following Best female trader on Twitter. Change my mind. 🔥 vegan dietitian. https://t.co/tqCUqnBG94 danamac.eth #GoCoogs Nothing said here is financial advice.
Otavio (Tavi) Costa @TaviCosta
222K Followers 2K Following Crescat Capital macro strategist. Native of Sao Paulo, Brazil 🇧https://t.co/YApL3RfM1A
ʎllǝuuop ʇuǝɹq @donnelly_brent
71K Followers 814 Following President of @Spectra_Markets. Author of am/FX and Alpha Trader. I like trading, table tennis, my family, writing, hard/fast music, and poker. Not in that order
Heisenberg @Mr_Derivatives
131K Followers 426 Following Stock Market Commentary. Long/Short Ideas. Technical Analysis. Occasional Rants. Sprinkle of Humor. Not Financial Advice. Other channel: @Heisenberg_100k
Michael R. Strain @MichaelRStrain
20K Followers 399 Following Director of Economic Policy Studies & Senior Fellow at @AEI. Professor of Practice at @Georgetown. Buy "The American Dream Is Not Dead": https://t.co/02npyRToUP.
John P. Hussman, Ph.D.. @hussmanjp
89K Followers 837 Following Philanthropist. Finance, economics, public policy, neuroscience, genomics, and a 6-string. Realistic optimist often mistaken for prophet of doom.
JustDario 🏊♂�.. @DarioCpx
36K Followers 372 Following Synnax COO | Clearpool | Crypto, Value, Macro and Facts. All my research on https://t.co/Qa8kCG3DpG
Nick Timiraos @NickTimiraos
325K Followers 110 Following Chief economics correspondent, The Wall Street Journal • Author, "Trillion Dollar Triage”
Steve Goldstein @MKTWgoldstein
18K Followers 2K Following I'm the European bureau chief for MarketWatch. Previous stints DC/London/NYC. Nominal debt scourge. Email [email protected]
Gunjan Banerji @GunjanJS
45K Followers 3K Following Covering markets & money @WSJ, Contributor @CNBC. Dancer. New Yorker. Reach me at [email protected] Views are my own.
Samantha LaDuc @SamanthaLaDuc
56K Followers 2K Following Proud Founder + Mother. Humbled Contributor: Bloomberg, CNBC, YahooFinance... Curious Cross-Asset Analyst. Persistent Trader on Chase, Swing + Trend Timeframes.
Lisa Abramowicz @lisaabramowicz1
378K Followers 1K Following Co-host of @bsurveillance; Sign up for the newsletter here: https://t.co/4EBiPWI8En
Warren Pies @WarrenPies
38K Followers 2K Following Founder @3F_Research...Formerly with Ned Davis Research, Recovering Attorney (step 4), Highlighting when I'm rt...downplaying when I'm wrong.
Michael J. Kramer @MichaelMOTTCM
118K Followers 621 Following You can visit my website to learn more about me and my Long-Only LT growth strategy. https://t.co/vqSVbYCFmX See disclosures in the link below
S&P 500 Signals @SPYSTSignals
19K Followers 177 Following I build and share quantitative models that *attempt* to predict future S&P 500 returns. All models are wrong, but some are useful. Subscribe ⬇
GURGAVIN @gurgavin
385K Followers 521 Following TECH FOCUSED INVESTOR & EVENT DRIVEN TRADER ( THIS IS MY ONLY ACCOUNT I WILL NEVER REACH OUT FROM ANY OTHER ACCOUNT )
Amitabha Bandyopadhy @abandopa
10K Followers 1K Following Trying to understand the Developmental Biology of vertebrate limb. In BMP I trust! All tweets are personal . RTs are not endorsements.
Porter Collins @Seawolfcap
42K Followers 2K Following Co-Founder of Seawolf Capital. Value investor, short seller and 2 time Olympian. Always looking for the next Big Short.
Prometheus Research @prometheusmacro
37K Followers 253 Following Research service with the goal of democratizing finance. Making institutional-quality insights and research available to the public.
Hindenburg Research @HindenburgRes
610K Followers 0 Following Popping bubbles as we see them. We express strong opinions. Not investment advice.
RTGamma @rt_gamma
7K Followers 44 Following Helping traders analyze real time SPX 0DTE options and gamma levels. https://t.co/cyTd8iRneE ** Information Only, Not Investment Advice **
Sergei Perfiliev 🇺.. @perfiliev
66K Followers 560 Following Ex-Goldman Sachs Quant | Options Trader | Finance Teacher | Software Developer Learn financial markets with our new training course! 👇
Bob Elliott @BobEUnlimited
139K Followers 689 Following CIO at @UnlimitedFnds | PM of $HFND | Fmr IC @Bridgewater | Described as one of the few "sane" voices on #fintwit | Comments are not investment advice
THE SHORT BEAR @TheShortBear
102K Followers 389 Following Stoic trader and investor | since 2013 | driven by Philosophy & Psychology | VC & PE|Tweets are purely for entertainment purposes and not investment advice
Steve Austin @steveaustinBSR
4.7M Followers 696 Following Instagram-@steveaustinBSR https://t.co/ZMA3ERY3ov
Dr. Nicole Paulk @Nicole_Paulk
6K Followers 640 Following CEO, Founder, President of @SirenBio. Universal #AAV #GeneTherapy for #Cancer.🦪 Oysters are my weakness.
Manisha Pai @mppai
1K Followers 694 Following Biotech investor relations. Voracious reader, eater & wine drinker. Ex-pat Mainer. Helicopter mom to a senior rescue dog. Tweets & opinions are my own. she/her
Dalai Lama @DalaiLama
18.6M Followers 0 Following Welcome to the official twitter page of the Office of His Holiness the 14th Dalai Lama.
Smokies Road Info @SmokiesRoadsNPS
109K Followers 1 Following Great Smoky Mountains NP road status updates (automated). For general park info follow @GreatSmokyNPS. More at https://t.co/yAHCvxoert & https://t.co/IlwJQ6Jq1i
Animals interrupting wildlife photographers - a thread 🧵 1. A curious fox by Dan Dinu
Holy crap had to pay for plane wifi just to post this. On my way home from Texas and look who’s on my flight LOL, you can’t make this up. Was insane meeting him 😭
@EvanWeberPhD Spring in #Philly another view
The beauty of spring around the world - a thread 🧵 1. A desert bloom in Utah by Emily Dickey
Grandpa casually teaching his grandson how to ride a bicycle when his muscle memory kicks in
Red cells trying not to become schistocytes in microangiopathic hemolytic anemia x.com/sadie2901/stat…
@gurgavin wonder if Tesla have 500,000 people in India driving FSD remotely 😝
A 5th star must be for bringing someone back from the dead
Honestly don't know how to earn that 5th star
AATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAGAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAAAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTGA
Happy CD3/CD28 T Cell Activation Day! 3/28
CDMO selection: critical considerations that can make or break your cell and gene therapy development @cytotherapy @ISCTglobal #celltherapy #genetherapy sciencedirect.com/science/articl…
BREAKING: Boeing has selected a new ceo
New study: a bacteria that normally lives in the mouth was found in 50% of colon cancers. This is consistent with prior research on the interactions between the microbiome and colon cancer, which is rising among young people. nature.com/articles/s4158….
Occam's Razor: The Simplest Explanation is the Best One Powell's dovish press conference yesterday, in the face of a drastic loosening of financial conditions which has re-ignited animal spirits, inflation expectations and actual inflation, can only be explained by the Fed's…
Key takeaways from the FOMC: - The Fed is in no hurry to bring inflation down to 2%. They don't even intend to achieve that goal until 2026. Powell's term ends in May 2026. Read into that what you will. - Treasury auctions are failing so the Fed announced QT taper. The…
🚨 US Ambassador to India, Eric Garcetti : "US can't give up on principles. US is concerned about CAA & closely monitoring it." EAM S Jaishankar : "Then, I have my principles too 🔥🔥. One of my principles is an obligation to the people wronged during partition." “You remove…
@PicturesFoIder Props to that soldier, real hero vibes. Racism's got no place in 2023, period.
@PicturesFoIder As an Asian person, i am so proud when the soldier said Asians do a lot for this country. Thank you. There are so many things we have in common in philosophy and character in America than what we look like. Being an American is a mindset.
Trends for United States
You might like
